mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 0.999999891876087 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | ||||||||||||
Summary |
|
hyperlink | ||||||||||||
analysed issue | analysis result | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | |||||||||||||
alteration (phys. location) | chr6:10687746G>TN/A show variant in all transcripts IGV | |||||||||||||
HGNC symbol | C6orf52 | |||||||||||||
Ensembl transcript ID | ENST00000503680 | |||||||||||||
Genbank transcript ID | N/A | |||||||||||||
UniProt peptide | N/A | |||||||||||||
alteration type | single base exchange | |||||||||||||
alteration region | intron | |||||||||||||
DNA changes | g.7285C>A | |||||||||||||
AA changes | N/A | |||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | |||||||||||||
frameshift | N/A | |||||||||||||
known variant | Reference ID: rs7749306
| |||||||||||||
regulatory features | H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation | |||||||||||||
phyloP / phastCons |
| |||||||||||||
splice sites |
| |||||||||||||
distance from splice site | 349 | |||||||||||||
Kozak consensus sequence altered? | N/A | |||||||||||||
conservation protein level for non-synonymous changes | N/A | |||||||||||||
protein features | N/A | |||||||||||||
length of protein | N/A | |||||||||||||
AA sequence altered | N/A | |||||||||||||
position of stopcodon in wt / mu CDS | N/A | |||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | |||||||||||||
position of stopcodon in wt / mu cDNA | N/A | |||||||||||||
poly(A) signal | N/A | |||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | |||||||||||||
position of start ATG in wt / mu cDNA | 367 / 367 | |||||||||||||
chromosome | 6 | |||||||||||||
strand | -1 | |||||||||||||
last intron/exon boundary | 506 | |||||||||||||
theoretical NMD boundary in CDS | 89 | |||||||||||||
length of CDS | 282 | |||||||||||||
coding sequence (CDS) position | N/A | |||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | N/A | |||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 7285 | |||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 10687746 | |||||||||||||
original gDNA sequence snippet | TTCTGCAGATTTTGGCATAGCTCAACAAAATAACTATTACT | |||||||||||||
altered gDNA sequence snippet | TTCTGCAGATTTTGGCATAGATCAACAAAATAACTATTACT | |||||||||||||
original cDNA sequence snippet | N/A | |||||||||||||
altered cDNA sequence snippet | N/A | |||||||||||||
wildtype AA sequence | METTPLAENQ DEDPLEVTSQ YVAQADLKLP DLSNSLVSAS QSVGVTDPHL HLNIEESNQE FMVKSEELYD SLMNCHWQPL DTVHSEIPDE TPK* | |||||||||||||
mutated AA sequence | N/A | |||||||||||||
speed | 0.67 s | |||||||||||||