Yum, tasty mutations...

mutation t@sting

documentation

Prediction

disease causing

Model: without_aae, prob: 1      (explain)
Summary
  • heterozygous in TGP or ExAC
  • known as potential disease variant: rs13228 (probable pathogenic)
  • known disease mutation at this position (HGMD CM062445)
  • protein features (might be) affected
  • splice site changes
hyperlink
analysed issue analysis result
name of alteration no title
alteration (phys. location) chr3:165547818A>GN/A show variant in all transcripts   IGV
HGNC symbol BCHE
Ensembl transcript ID ENST00000540653
Genbank transcript ID N/A
UniProt peptide P06276
alteration type single base exchange
alteration region intron
DNA changes g.7443T>C
AA changes N/A
position(s) of altered AA
if AA alteration in CDS
N/A
frameshift N/A
known variant Reference ID: rs104893684
databasehomozygous (G/G)heterozygousallele carriers
1000G257
ExAC13738

known as potential disease variant: rs13228 (probable pathogenic for Deficiency of butyrylcholine esterase) dbSNP  NCBI variation viewer
known disease mutation at this position, please check HGMD for details (HGMD ID CM062445)

known disease mutation at this position, please check HGMD for details (HGMD ID CM062445)
known disease mutation at this position, please check HGMD for details (HGMD ID CM062445)
regulatory features N/A
phyloP / phastCons
PhyloPPhastCons
(flanking)-0.3550.32
4.2670.749
(flanking)2.0460.727
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
splice sites splice site change before start ATG (at aa -31) |
effectgDNA positionscoredetection sequence  exon-intron border
Donor gained74420.35mu: TATTACCTGAACTTG TTAC|ctga
distance from splice site 7284
Kozak consensus sequence altered? N/A
conservation
protein level for non-synonymous changes
N/A
protein features
start (aa)end (aa)featuredetails 
128SIGNALmight get lost (downstream of altered splice site)
3336STRANDmight get lost (downstream of altered splice site)
3942STRANDmight get lost (downstream of altered splice site)
4448STRANDmight get lost (downstream of altered splice site)
4545CARBOHYDN-linked (GlcNAc...).might get lost (downstream of altered splice site)
5160STRANDmight get lost (downstream of altered splice site)
6769HELIXmight get lost (downstream of altered splice site)
8285STRANDmight get lost (downstream of altered splice site)
8585CARBOHYDN-linked (GlcNAc...).might get lost (downstream of altered splice site)
9393DISULFIDmight get lost (downstream of altered splice site)
105108HELIXmight get lost (downstream of altered splice site)
116118STRANDmight get lost (downstream of altered splice site)
120120DISULFIDmight get lost (downstream of altered splice site)
122130STRANDmight get lost (downstream of altered splice site)
133141STRANDmight get lost (downstream of altered splice site)
134134CARBOHYDN-linked (GlcNAc...).might get lost (downstream of altered splice site)
144145REGIONSubstrate binding.might get lost (downstream of altered splice site)
145147TURNmight get lost (downstream of altered splice site)
154156HELIXmight get lost (downstream of altered splice site)
159165HELIXmight get lost (downstream of altered splice site)
168172STRANDmight get lost (downstream of altered splice site)
177181HELIXmight get lost (downstream of altered splice site)
190192STRANDmight get lost (downstream of altered splice site)
194209HELIXmight get lost (downstream of altered splice site)
210213HELIXmight get lost (downstream of altered splice site)
215225STRANDmight get lost (downstream of altered splice site)
226226ACT_SITEAcyl-ester intermediate.might get lost (downstream of altered splice site)
227237HELIXmight get lost (downstream of altered splice site)
239244HELIXmight get lost (downstream of altered splice site)
246252STRANDmight get lost (downstream of altered splice site)
258260TURNmight get lost (downstream of altered splice site)
264277HELIXmight get lost (downstream of altered splice site)
269269CARBOHYDN-linked (GlcNAc...).might get lost (downstream of altered splice site)
280280DISULFIDmight get lost (downstream of altered splice site)
284284CARBOHYDN-linked (GlcNAc...).might get lost (downstream of altered splice site)
285292HELIXmight get lost (downstream of altered splice site)
291291DISULFIDmight get lost (downstream of altered splice site)
297304HELIXmight get lost (downstream of altered splice site)
305307HELIXmight get lost (downstream of altered splice site)
308310STRANDmight get lost (downstream of altered splice site)
324326STRANDmight get lost (downstream of altered splice site)
331336HELIXmight get lost (downstream of altered splice site)
345350STRANDmight get lost (downstream of altered splice site)
352354STRANDmight get lost (downstream of altered splice site)
353353ACT_SITECharge relay system.might get lost (downstream of altered splice site)
355358HELIXmight get lost (downstream of altered splice site)
359361TURNmight get lost (downstream of altered splice site)
367369STRANDmight get lost (downstream of altered splice site)
369369CARBOHYDN-linked (GlcNAc...).might get lost (downstream of altered splice site)
375385HELIXmight get lost (downstream of altered splice site)
387389STRANDmight get lost (downstream of altered splice site)
391401HELIXmight get lost (downstream of altered splice site)
405408TURNmight get lost (downstream of altered splice site)
412425HELIXmight get lost (downstream of altered splice site)
427438HELIXmight get lost (downstream of altered splice site)
428428DISULFIDmight get lost (downstream of altered splice site)
439441TURNmight get lost (downstream of altered splice site)
444449STRANDmight get lost (downstream of altered splice site)
460462HELIXmight get lost (downstream of altered splice site)
466466ACT_SITECharge relay system.might get lost (downstream of altered splice site)
466469TURNmight get lost (downstream of altered splice site)
470473HELIXmight get lost (downstream of altered splice site)
476478HELIXmight get lost (downstream of altered splice site)
480482HELIXmight get lost (downstream of altered splice site)
483483CARBOHYDN-linked (GlcNAc...).might get lost (downstream of altered splice site)
486505HELIXmight get lost (downstream of altered splice site)
509509CARBOHYDN-linked (GlcNAc...).might get lost (downstream of altered splice site)
511514TURNmight get lost (downstream of altered splice site)
513513CARBOHYDN-linked (GlcNAc...).might get lost (downstream of altered splice site)
514514CARBOHYDN-linked (GlcNAc...).might get lost (downstream of altered splice site)
523525TURNmight get lost (downstream of altered splice site)
527531STRANDmight get lost (downstream of altered splice site)
538541STRANDmight get lost (downstream of altered splice site)
544551HELIXmight get lost (downstream of altered splice site)
547547DISULFIDmight get lost (downstream of altered splice site)
552555TURNmight get lost (downstream of altered splice site)
599599DISULFIDInterchain.might get lost (downstream of altered splice site)
599599DISULFIDInterchain.might get lost (downstream of altered splice site)
length of protein N/A
AA sequence altered N/A
position of stopcodon in wt / mu CDS N/A
position (AA) of stopcodon in wt / mu AA sequence N/A
position of stopcodon in wt / mu cDNA N/A
poly(A) signal N/A
conservation
nucleotide level for all changes - no scoring up to now
N/A
position of start ATG in wt / mu cDNA 205 / 205
chromosome 3
strand -1
last intron/exon boundary 275
theoretical NMD boundary in CDS 20
length of CDS 195
coding sequence (CDS) position N/A
cDNA position
(for ins/del: last normal base / first normal base)
N/A
gDNA position
(for ins/del: last normal base / first normal base)
7443
chromosomal position
(for ins/del: last normal base / first normal base)
165547818
original gDNA sequence snippet TGACATGCCAGACATATTACTTGAACTTGGACAATTTAAAA
altered gDNA sequence snippet TGACATGCCAGACATATTACCTGAACTTGGACAATTTAAAA
original cDNA sequence snippet N/A
altered cDNA sequence snippet N/A
wildtype AA sequence MTKLRAQQCR FWTSFFPKVL EMTGNIDEAE WEWKAGFHRW NNYMMDWKNQ FNDYTSKKES
CVGL*
mutated AA sequence N/A
speed 0.81 s
All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project