Prediction |
polymorphism |
Model: without_aae, prob: 0.999999500995116 (classification due to TGP/ExAC,
real probability is shown anyway)
(explain) |
Summary |
- homozygous in TGP or ExAC
- known disease mutation at this position (HGMD CM1512799)
- protein features (might be) affected
- splice site changes
|
hyperlink |
analysed issue |
analysis result |
name of alteration | no title |
alteration (phys. location) | chr11:614318T>CN/A
show variant in all transcripts IGV
|
HGNC symbol | IRF7 |
Ensembl transcript ID | ENST00000397562 |
Genbank transcript ID | N/A |
UniProt peptide | Q92985 |
alteration type | single base exchange |
alteration region | intron |
DNA changes | g.1682A>G |
AA changes | N/A |
position(s) of altered AA if AA alteration in CDS | N/A |
frameshift | N/A |
known variant | Reference ID: rs1061502
database | homozygous (C/C) | heterozygous | allele carriers |
1000G | 300 | 780 | 1080 |
ExAC | 4282 | 20425 | 24707 |
known disease mutation at this position, please check HGMD for details (HGMD ID CM1512799)
|
regulatory features | H3K4me2, Histone, Histone 3 Lysine 4 Di-Methylation PolII, Polymerase, RNA Polymerase II H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation H4K20me1, Histone, Histone 4 Lysine 20 mono-methylation H3K79me2, Histone, Histone 3 Lysine 79 di-methylation H3K9ac, Histone, Histone 3 Lysine 9 Acetylation H3K27ac, Histone, Histone 3 Lysine 27 Acetylation H3K4me1, Histone, Histone 3 Lysine 4 Mono-Methylation H3K4me3, Histone, Histone 3 Lysine 4 Tri-Methylation |
phyloP / phastCons | | PhyloP | PhastCons |
(flanking) | 0.267 | 0.001 | | -2.28 | 0 | (flanking) | -0.394 | 0 | explain score(s) and/or inspect your position(s) in in UCSC Genome Browser |
splice sites | splice site change before start ATG (at aa -94) | effect | gDNA position | score | detection sequence | exon-intron border | Acc increased | 1673 | wt: 0.67 / mu: 0.79 | wt: CAGGCCCCCTCCCTGCCCCAGCTGGTGACAAGGGGGACCTC mu: CAGGCCCCCTCCCTGCCCCAGCTGGTGACGAGGGGGACCTC | ccag|CTGG | Acc marginally increased | 1676 | wt: 0.7784 / mu: 0.7825 (marginal change - not scored) | wt: GCCCCCTCCCTGCCCCAGCTGGTGACAAGGGGGACCTCCTG mu: GCCCCCTCCCTGCCCCAGCTGGTGACGAGGGGGACCTCCTG | gctg|GTGA | Donor increased | 1676 | wt: 0.23 / mu: 0.97 | wt: CAGCTGGTGACAAGG mu: CAGCTGGTGACGAGG | GCTG|gtga | Donor gained | 1681 | 0.50 | mu: GGTGACGAGGGGGAC | TGAC|gagg |
|
distance from splice site | 158 |
Kozak consensus sequence altered? | N/A |
conservation protein level for non-synonymous changes | N/A |
protein features | start (aa) | end (aa) | feature | details | | 11 | 126 | DNA_BIND | IRF tryptophan pentad repeat. | might get lost (downstream of altered splice site) | 14 | 24 | HELIX | | might get lost (downstream of altered splice site) | 31 | 36 | STRAND | | might get lost (downstream of altered splice site) | 39 | 43 | STRAND | | might get lost (downstream of altered splice site) | 55 | 57 | HELIX | | might get lost (downstream of altered splice site) | 58 | 66 | HELIX | | might get lost (downstream of altered splice site) | 84 | 102 | HELIX | | might get lost (downstream of altered splice site) | 90 | 90 | MUTAGEN | G->T: Loss of acetylation, increased DNA- binding and activity; when associated with R-93. | might get lost (downstream of altered splice site) | 92 | 92 | MUTAGEN | K->R: Loss of acetylation, DNA-binding and activity. | might get lost (downstream of altered splice site) | 92 | 92 | MOD_RES | N6-acetyllysine; by KAT2A and KAT2B. | might get lost (downstream of altered splice site) | 93 | 93 | MUTAGEN | T->R: Loss of acetylation, increased DNA- binding and activity; when associated with T-90. | might get lost (downstream of altered splice site) | 105 | 112 | STRAND | | might get lost (downstream of altered splice site) | 119 | 125 | STRAND | | might get lost (downstream of altered splice site) | 444 | 444 | CROSSLNK | Glycyl lysine isopeptide (Lys-Gly) (interchain with G-Cter in SUMO). | might get lost (downstream of altered splice site) | 446 | 446 | CROSSLNK | Glycyl lysine isopeptide (Lys-Gly) (interchain with G-Cter in SUMO). | might get lost (downstream of altered splice site) | 471 | 471 | MOD_RES | Phosphoserine (By similarity). | might get lost (downstream of altered splice site) | 472 | 472 | MOD_RES | Phosphoserine (By similarity). | might get lost (downstream of altered splice site) | 477 | 477 | MOD_RES | Phosphoserine; by TBK1 and IKKE. | might get lost (downstream of altered splice site) | 477 | 479 | MUTAGEN | SLS->ALA: Complete loss of TBK1 and IKKE phosphorylation. | might get lost (downstream of altered splice site) | 479 | 479 | MOD_RES | Phosphoserine; by TBK1 and IKKE. | might get lost (downstream of altered splice site) | 483 | 483 | MOD_RES | Phosphoserine (By similarity). | might get lost (downstream of altered splice site) | 484 | 484 | MOD_RES | Phosphoserine (By similarity). | might get lost (downstream of altered splice site) |
|
length of protein | N/A |
AA sequence altered | N/A |
position of stopcodon in wt / mu CDS | N/A |
position (AA) of stopcodon in wt / mu AA sequence | N/A |
position of stopcodon in wt / mu cDNA | N/A |
poly(A) signal | N/A |
conservation nucleotide level for all changes - no scoring up to now | N/A |
position of start ATG in wt / mu cDNA | 1060 / 1060 |
chromosome | 11 |
strand | -1 |
last intron/exon boundary | 1537 |
theoretical NMD boundary in CDS | 427 |
length of CDS | 633 |
coding sequence (CDS) position | N/A |
cDNA position (for ins/del: last normal base / first normal base) | N/A |
gDNA position (for ins/del: last normal base / first normal base) | 1682 |
chromosomal position (for ins/del: last normal base / first normal base) | 614318 |
original gDNA sequence snippet | TCCCTGCCCCAGCTGGTGACAAGGGGGACCTCCTGCTCCAG |
altered gDNA sequence snippet | TCCCTGCCCCAGCTGGTGACGAGGGGGACCTCCTGCTCCAG |
original cDNA sequence snippet | N/A |
altered cDNA sequence snippet | N/A |
wildtype AA sequence | MYKGRTVLQK VVGHPSCTFL YGPPDPAVRA TDPQQVAFPS PAELPDQKQL RYTEELLRHV APGLHLELRG PQLWARRMGK CKVYWEVGGP PGSASPSTPA CLLPRNCDTP IFDFRVFFQE LVEFRARQRR GSPRYTIYLG FGQDLSAGRP KEKSLVLVKL EPWLCRVHLE GTQREGVSSL DSSSLSLCLS SANSLYDDIE CFLMELEQPA * |
mutated AA sequence | N/A |
speed | 0.68 s |
|
|