mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 0.999999759638194 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | |||||||||||||||||||||||||
Summary |
|
hyperlink | |||||||||||||||||||||||||
analysed issue | analysis result | ||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | ||||||||||||||||||||||||||
alteration (phys. location) | chr15:40915190A>GN/A show variant in all transcripts IGV | ||||||||||||||||||||||||||
HGNC symbol | KNL1 | ||||||||||||||||||||||||||
Ensembl transcript ID | ENST00000527044 | ||||||||||||||||||||||||||
Genbank transcript ID | N/A | ||||||||||||||||||||||||||
UniProt peptide | N/A | ||||||||||||||||||||||||||
alteration type | single base exchange | ||||||||||||||||||||||||||
alteration region | 3'UTR | ||||||||||||||||||||||||||
DNA changes | cDNA.3044A>G g.28973A>G | ||||||||||||||||||||||||||
AA changes | N/A | ||||||||||||||||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | ||||||||||||||||||||||||||
frameshift | N/A | ||||||||||||||||||||||||||
known variant | Reference ID: rs8040502
| ||||||||||||||||||||||||||
regulatory features | H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation H3K4me1, Histone, Histone 3 Lysine 4 Mono-Methylation | ||||||||||||||||||||||||||
phyloP / phastCons |
| ||||||||||||||||||||||||||
splice sites | splice site change occurs after stopcodon (at aa 886) splice site change occurs after stopcodon (at aa 889)
| ||||||||||||||||||||||||||
distance from splice site | 168 | ||||||||||||||||||||||||||
Kozak consensus sequence altered? | N/A | ||||||||||||||||||||||||||
conservation protein level for non-synonymous changes | N/A | ||||||||||||||||||||||||||
protein features | N/A | ||||||||||||||||||||||||||
length of protein | N/A | ||||||||||||||||||||||||||
AA sequence altered | N/A | ||||||||||||||||||||||||||
position of stopcodon in wt / mu CDS | N/A | ||||||||||||||||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | ||||||||||||||||||||||||||
position of stopcodon in wt / mu cDNA | N/A | ||||||||||||||||||||||||||
poly(A) signal | unique in [sequence type]: position, polyA signal, score unique in >mutated: 30888, AATAAA, 0.203387 | ||||||||||||||||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | ||||||||||||||||||||||||||
position of start ATG in wt / mu cDNA | 376 / 376 | ||||||||||||||||||||||||||
chromosome | 15 | ||||||||||||||||||||||||||
strand | 1 | ||||||||||||||||||||||||||
last intron/exon boundary | 692 | ||||||||||||||||||||||||||
theoretical NMD boundary in CDS | 266 | ||||||||||||||||||||||||||
length of CDS | 342 | ||||||||||||||||||||||||||
coding sequence (CDS) position | N/A | ||||||||||||||||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | 3044 | ||||||||||||||||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 28973 | ||||||||||||||||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 40915190 | ||||||||||||||||||||||||||
original gDNA sequence snippet | AAACTATTTTATATACATGTAGGCAGGATGACATGGAGATC | ||||||||||||||||||||||||||
altered gDNA sequence snippet | AAACTATTTTATATACATGTGGGCAGGATGACATGGAGATC | ||||||||||||||||||||||||||
original cDNA sequence snippet | AAACTATTTTATATACATGTAGGCAGGATGACATGGAGATC | ||||||||||||||||||||||||||
altered cDNA sequence snippet | AAACTATTTTATATACATGTGGGCAGGATGACATGGAGATC | ||||||||||||||||||||||||||
wildtype AA sequence | MDGVSSEANE ENDNIERPVR RRHSSILKPP RSPLQDLRGG NERVQESNAL RNKKNSRRVS FADTIKVFQT ESHMKIVRKS EMEETGENLL LIQNKKLEDN YCEITVFNYR TYP* | ||||||||||||||||||||||||||
mutated AA sequence | N/A | ||||||||||||||||||||||||||
speed | 0.91 s | ||||||||||||||||||||||||||