mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 5.59268526953699e-18 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | ||||||||||||||||||||
Summary |
|
hyperlink | ||||||||||||||||||||
analysed issue | analysis result | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | |||||||||||||||||||||
alteration (phys. location) | chr12:108956433C>TN/A show variant in all transcripts IGV | |||||||||||||||||||||
HGNC symbol | ISCU | |||||||||||||||||||||
Ensembl transcript ID | ENST00000338291 | |||||||||||||||||||||
Genbank transcript ID | N/A | |||||||||||||||||||||
UniProt peptide | Q9H1K1 | |||||||||||||||||||||
alteration type | single base exchange | |||||||||||||||||||||
alteration region | 5'UTR | |||||||||||||||||||||
DNA changes | cDNA.52C>T g.76C>T | |||||||||||||||||||||
AA changes | N/A | |||||||||||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | |||||||||||||||||||||
frameshift | N/A | |||||||||||||||||||||
known variant | Reference ID: rs2287555
| |||||||||||||||||||||
regulatory features | ATF3, Transcription Factor, ATF3 Transcription Factor Binding Cmyc, Transcription Factor, Cmyc TF binding DNase1, Open Chromatin, DNase1 Hypersensitive Site E2F4, Transcription Factor, E2F4 Transcription Factor Binding ELF1, Transcription Factor, ELF1 Transcription Factor Binding H2BK120ac, Histone, Histone 2B Lysine 120 Acetylation H2BK20ac, Histone, Histone 2B Lysine 20 Acetylation H2BK5ac, Histone, Histone 2B Lysine 5 Acetylation H3K27ac, Histone, Histone 3 Lysine 27 Acetylation H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation H3K4me2, Histone, Histone 3 Lysine 4 Di-Methylation H3K4me3, Histone, Histone 3 Lysine 4 Tri-Methylation H3K79me2, Histone, Histone 3 Lysine 79 di-methylation H3K9ac, Histone, Histone 3 Lysine 9 Acetylation H4K91ac, Histone, Histone 4 Lysine 91 Acetylation HEY1, Transcription Factor, HEY1 Transcription Factor Binding Jund, Transcription Factor, Jund TF binding Max, Transcription Factor, Max TF binding PolII, Polymerase, RNA Polymerase II Promoter Associated, Regulatory Feature, Promoter like regulatory feature Srf, Transcription Factor, Srf TF binding TAF1, Transcription Factor, TAF1 Transcription Factor Binding Yy1, Transcription Factor, Yy1 Transcription Factor Binding | |||||||||||||||||||||
phyloP / phastCons |
| |||||||||||||||||||||
splice sites | splice site change before start ATG (at aa -47) |
| |||||||||||||||||||||
distance from splice site | 52 | |||||||||||||||||||||
Kozak consensus sequence altered? | no | |||||||||||||||||||||
conservation protein level for non-synonymous changes | N/A | |||||||||||||||||||||
protein features |
| |||||||||||||||||||||
length of protein | N/A | |||||||||||||||||||||
AA sequence altered | N/A | |||||||||||||||||||||
position of stopcodon in wt / mu CDS | N/A | |||||||||||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | |||||||||||||||||||||
position of stopcodon in wt / mu cDNA | N/A | |||||||||||||||||||||
poly(A) signal | N/A | |||||||||||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | |||||||||||||||||||||
position of start ATG in wt / mu cDNA | 189 / 189 | |||||||||||||||||||||
chromosome | 12 | |||||||||||||||||||||
strand | 1 | |||||||||||||||||||||
last intron/exon boundary | 632 | |||||||||||||||||||||
theoretical NMD boundary in CDS | 393 | |||||||||||||||||||||
length of CDS | 390 | |||||||||||||||||||||
coding sequence (CDS) position | N/A | |||||||||||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | 52 | |||||||||||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 76 | |||||||||||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 108956433 | |||||||||||||||||||||
original gDNA sequence snippet | GGCTTTCCGTCTGAGGCGGGCGGCATCGGCTCTGCTGCTGC | |||||||||||||||||||||
altered gDNA sequence snippet | GGCTTTCCGTCTGAGGCGGGTGGCATCGGCTCTGCTGCTGC | |||||||||||||||||||||
original cDNA sequence snippet | GGCTTTCCGTCTGAGGCGGGCGGCATCGGCTCTGCTGCTGC | |||||||||||||||||||||
altered cDNA sequence snippet | GGCTTTCCGTCTGAGGCGGGTGGCATCGGCTCTGCTGCTGC | |||||||||||||||||||||
wildtype AA sequence | MVLIDMSVDL STQVVDHYEN PRNVGSLDKT SKNVGTGLVG APACGDVMKL QIQVDEKGKI VDARFKTFGC GSAIASSSLA TEWVKGKTVE EALTIKNTDI AKELCLPPVK LHCSKSVLFP AEEKTQLSP* | |||||||||||||||||||||
mutated AA sequence | N/A | |||||||||||||||||||||
speed | 0.37 s | |||||||||||||||||||||