Prediction |
disease causing |
Model: without_aae, prob: 1 (classification due to ClinVar,
real probability is shown anyway)
(explain) |
Summary |
- known disease mutation at this position (HGMD CM960670)
- known disease mutation: rs12006 (pathogenic)
- protein features (might be) affected
- splice site changes
|
hyperlink |
analysed issue |
analysis result |
name of alteration | no title |
alteration (phys. location) | chr17:41059569G>AN/A
show variant in all transcripts IGV
|
HGNC symbol | G6PC |
Ensembl transcript ID | ENST00000592383 |
Genbank transcript ID | N/A |
UniProt peptide | P35575 |
alteration type | single base exchange |
alteration region | intron |
DNA changes | g.6756G>A |
AA changes | N/A |
position(s) of altered AA if AA alteration in CDS | N/A |
frameshift | N/A |
known variant | Reference ID: rs104894568
Allele 'A' was neither found in ExAC nor 1000G. known disease mutation: rs12006 (pathogenic for Glycogen storage disease due to glucose-6-phosphatase deficiency type IA) dbSNP
NCBI variation viewer known disease mutation at this position, please check HGMD for details (HGMD ID CM960670)
known disease mutation at this position, please check HGMD for details (HGMD ID CM960670) known disease mutation at this position, please check HGMD for details (HGMD ID CM960670)
|
regulatory features | H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation |
phyloP / phastCons | | PhyloP | PhastCons |
(flanking) | -0.086 | 0.969 | | 5.827 | 1 | (flanking) | 5.827 | 1 | explain score(s) and/or inspect your position(s) in in UCSC Genome Browser |
splice sites | effect | gDNA position | score | wt detection sequence | exon-intron border | Donor increased | 6758 | wt: 0.39 / mu: 0.51 | wt: ACAGCAGGTGTATAC mu: ACAACAGGTGTATAC | AGCA|ggtg | Donor gained | 6756 | 0.86 | mu: GCACAACAGGTGTAT | ACAA|cagg | Donor gained | 6754 | 0.43 | mu: GGGCACAACAGGTGT | GCAC|aaca |
|
distance from splice site | 48 |
Kozak consensus sequence altered? | N/A |
conservation protein level for non-synonymous changes | N/A |
protein features | start (aa) | end (aa) | feature | details | | 82 | 117 | TOPO_DOM | Lumenal (Potential). | might get lost (downstream of altered splice site) | 118 | 138 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 119 | 119 | ACT_SITE | Proton donor (Potential). | might get lost (downstream of altered splice site) | 119 | 119 | MUTAGEN | H->A: Loss of catalytic activity. | might get lost (downstream of altered splice site) | 139 | 147 | TOPO_DOM | Cytoplasmic (Potential). | might get lost (downstream of altered splice site) | 148 | 168 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 169 | 179 | TOPO_DOM | Lumenal (Potential). | might get lost (downstream of altered splice site) | 170 | 170 | BINDING | Substrate (Potential). | might get lost (downstream of altered splice site) | 176 | 176 | MUTAGEN | H->A: Loss of catalytic activity. | might get lost (downstream of altered splice site) | 176 | 176 | ACT_SITE | Nucleophile. | might get lost (downstream of altered splice site) | 179 | 179 | MUTAGEN | H->A: Loss of catalytic activity. | might get lost (downstream of altered splice site) | 180 | 202 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 192 | 192 | CONFLICT | A -> T (in Ref. 1; AAA16222). | might get lost (downstream of altered splice site) | 197 | 197 | MUTAGEN | H->T: Partial loss of catalytic activity. | might get lost (downstream of altered splice site) | 203 | 209 | TOPO_DOM | Cytoplasmic (Potential). | might get lost (downstream of altered splice site) | 210 | 230 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 231 | 254 | TOPO_DOM | Lumenal (Potential). | might get lost (downstream of altered splice site) | 252 | 252 | MUTAGEN | H->A: Partial loss of catalytic activity. | might get lost (downstream of altered splice site) | 255 | 275 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 276 | 291 | TOPO_DOM | Cytoplasmic (Potential). | might get lost (downstream of altered splice site) | 292 | 312 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 307 | 307 | MUTAGEN | H->A: Partial loss of catalytic activity. | might get lost (downstream of altered splice site) | 313 | 320 | TOPO_DOM | Lumenal (Potential). | might get lost (downstream of altered splice site) | 321 | 341 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 342 | 357 | TOPO_DOM | Cytoplasmic (Potential). | might get lost (downstream of altered splice site) | 353 | 353 | MUTAGEN | H->A: Partial loss of catalytic activity. | might get lost (downstream of altered splice site) |
|
length of protein | N/A |
AA sequence altered | N/A |
position of stopcodon in wt / mu CDS | N/A |
position (AA) of stopcodon in wt / mu AA sequence | N/A |
position of stopcodon in wt / mu cDNA | N/A |
poly(A) signal | N/A |
conservation nucleotide level for all changes - no scoring up to now | N/A |
position of start ATG in wt / mu cDNA | 81 / 81 |
chromosome | 17 |
strand | 1 |
last intron/exon boundary | 566 |
theoretical NMD boundary in CDS | 435 |
length of CDS | 531 |
coding sequence (CDS) position | N/A |
cDNA position (for ins/del: last normal base / first normal base) | N/A |
gDNA position (for ins/del: last normal base / first normal base) | 6756 |
chromosomal position (for ins/del: last normal base / first normal base) | 41059569 |
original gDNA sequence snippet | CTGGCCATGCCATGGGCACAGCAGGTGTATACTACGTGATG |
altered gDNA sequence snippet | CTGGCCATGCCATGGGCACAACAGGTGTATACTACGTGATG |
original cDNA sequence snippet | N/A |
altered cDNA sequence snippet | N/A |
wildtype AA sequence | MEEGMNVLHD FGIQSTHYLQ VNYQDSQDWF ILVSVIADLR NAFYVLFPIW FHLQEAVGIK LLWVAVIGDW LNLVFKWILF GQRPYWWVLD TDYYSNTSVP LIKQFPVTCE TGPGKDKADL QISVLECHFV VGILGCAAEC LSVTNLPCCS FSSSSCCWSP VRHCCCRNFQ PHPQHL* |
mutated AA sequence | N/A |
speed | 1.59 s |
|
|