Prediction |
polymorphism |
Model: without_aae, prob: 0.999998238262633 (classification due to TGP/ExAC,
real probability is shown anyway)
(explain) |
Summary |
- homozygous in TGP or ExAC
- protein features (might be) affected
- splice site changes
|
hyperlink |
analysed issue |
analysis result |
name of alteration | no title |
alteration (phys. location) | chr3:12875443G>AN/A
show variant in all transcripts IGV
|
HGNC symbol | CAND2 |
Ensembl transcript ID | ENST00000454887 |
Genbank transcript ID | N/A |
UniProt peptide | O75155 |
alteration type | single base exchange |
alteration region | intron |
DNA changes | g.37473G>A |
AA changes | N/A |
position(s) of altered AA if AA alteration in CDS | N/A |
frameshift | N/A |
known variant | Reference ID: rs12629133
database | homozygous (A/A) | heterozygous | allele carriers |
1000G | 540 | 1178 | 1718 |
ExAC | 19243 | -5719 | 13524 |
|
regulatory features | PolII, Polymerase, RNA Polymerase II H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation H4K20me1, Histone, Histone 4 Lysine 20 mono-methylation |
phyloP / phastCons | | PhyloP | PhastCons |
(flanking) | -2.132 | 0 | | 0.15 | 0.007 | (flanking) | 0.801 | 0.076 | explain score(s) and/or inspect your position(s) in in UCSC Genome Browser |
splice sites | effect | gDNA position | score | wt detection sequence | exon-intron border | Donor gained | 37473 | 0.44 | mu: ATTCCACTTCAGCCC | TCCA|cttc |
|
distance from splice site | 2372 |
Kozak consensus sequence altered? | N/A |
conservation protein level for non-synonymous changes | N/A |
protein features | start (aa) | end (aa) | feature | details | | 83 | 119 | REPEAT | HEAT 3. | might get lost (downstream of altered splice site) | 129 | 167 | REPEAT | HEAT 4. | might get lost (downstream of altered splice site) | 171 | 208 | REPEAT | HEAT 5. | might get lost (downstream of altered splice site) | 204 | 204 | CONFLICT | A -> T (in Ref. 6; BAA31642). | might get lost (downstream of altered splice site) | 210 | 246 | REPEAT | HEAT 6. | might get lost (downstream of altered splice site) | 254 | 291 | REPEAT | HEAT 7. | might get lost (downstream of altered splice site) | 327 | 368 | REPEAT | HEAT 8. | might get lost (downstream of altered splice site) | 343 | 346 | COMPBIAS | Poly-Asp. | might get lost (downstream of altered splice site) | 372 | 409 | REPEAT | HEAT 9. | might get lost (downstream of altered splice site) | 432 | 469 | REPEAT | HEAT 10. | might get lost (downstream of altered splice site) | 490 | 493 | COMPBIAS | Poly-Ser. | might get lost (downstream of altered splice site) | 517 | 554 | REPEAT | HEAT 11. | might get lost (downstream of altered splice site) | 565 | 604 | REPEAT | HEAT 12. | might get lost (downstream of altered splice site) | 608 | 645 | REPEAT | HEAT 13. | might get lost (downstream of altered splice site) | 614 | 618 | COMPBIAS | Poly-Leu. | might get lost (downstream of altered splice site) | 648 | 685 | REPEAT | HEAT 14. | might get lost (downstream of altered splice site) | 690 | 727 | REPEAT | HEAT 15. | might get lost (downstream of altered splice site) | 731 | 770 | REPEAT | HEAT 16. | might get lost (downstream of altered splice site) | 772 | 813 | REPEAT | HEAT 17. | might get lost (downstream of altered splice site) | 857 | 894 | REPEAT | HEAT 18. | might get lost (downstream of altered splice site) | 896 | 931 | REPEAT | HEAT 19. | might get lost (downstream of altered splice site) | 933 | 966 | REPEAT | HEAT 20. | might get lost (downstream of altered splice site) | 967 | 1003 | REPEAT | HEAT 21. | might get lost (downstream of altered splice site) | 1007 | 1044 | REPEAT | HEAT 22. | might get lost (downstream of altered splice site) | 1048 | 1084 | REPEAT | HEAT 23. | might get lost (downstream of altered splice site) | 1105 | 1141 | REPEAT | HEAT 24. | might get lost (downstream of altered splice site) | 1157 | 1194 | REPEAT | HEAT 25. | might get lost (downstream of altered splice site) | 1173 | 1173 | MOD_RES | N6-acetyllysine. | might get lost (downstream of altered splice site) | 1204 | 1236 | REPEAT | HEAT 26. | might get lost (downstream of altered splice site) |
|
length of protein | N/A |
AA sequence altered | N/A |
position of stopcodon in wt / mu CDS | N/A |
position (AA) of stopcodon in wt / mu AA sequence | N/A |
position of stopcodon in wt / mu cDNA | N/A |
poly(A) signal | N/A |
conservation nucleotide level for all changes - no scoring up to now | N/A |
position of start ATG in wt / mu cDNA | 1 / 1 |
chromosome | 3 |
strand | 1 |
last intron/exon boundary | 470 |
theoretical NMD boundary in CDS | 419 |
length of CDS | 492 |
coding sequence (CDS) position | N/A |
cDNA position (for ins/del: last normal base / first normal base) | N/A |
gDNA position (for ins/del: last normal base / first normal base) | 37473 |
chromosomal position (for ins/del: last normal base / first normal base) | 12875443 |
original gDNA sequence snippet | AAAGCATCCAGAAGGATTCCGCTTCAGCCCCCAGCACAGAC |
altered gDNA sequence snippet | AAAGCATCCAGAAGGATTCCACTTCAGCCCCCAGCACAGAC |
original cDNA sequence snippet | N/A |
altered cDNA sequence snippet | N/A |
wildtype AA sequence | MGPFKHTVDD GLDVRKAAFE CMYSLLESCL GQLDICEFLN HVEDGLKDHY DIRMLTFIMV ARLATLCPAP VLQRVDRLIE PLRATCTAKE PNANSVAWNT QCEDMHALLL GRRLPQHQSQ HLPYAPAEAA GLCGRLQWLQ DLLPPCLLHF CRGGAADWRG RRP* |
mutated AA sequence | N/A |
speed | 1.00 s |
|
|