mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 6.50949668021815e-58 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | ||||||||||||||||||||||||||||||
Summary |
|
hyperlink | ||||||||||||||||||||||||||||||
analysed issue | analysis result | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | |||||||||||||||||||||||||||||||
alteration (phys. location) | chr12:89916811C>TN/A show variant in all transcripts IGV | |||||||||||||||||||||||||||||||
HGNC symbol | POC1B-GALNT4 | |||||||||||||||||||||||||||||||
Ensembl transcript ID | ENST00000547474 | |||||||||||||||||||||||||||||||
Genbank transcript ID | N/A | |||||||||||||||||||||||||||||||
UniProt peptide | N/A | |||||||||||||||||||||||||||||||
alteration type | single base exchange | |||||||||||||||||||||||||||||||
alteration region | 3'UTR | |||||||||||||||||||||||||||||||
DNA changes | cDNA.1107G>A g.3229G>A | |||||||||||||||||||||||||||||||
AA changes | N/A | |||||||||||||||||||||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | |||||||||||||||||||||||||||||||
frameshift | N/A | |||||||||||||||||||||||||||||||
known variant | Reference ID: rs2230283
| |||||||||||||||||||||||||||||||
regulatory features | H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation H3K4me1, Histone, Histone 3 Lysine 4 Mono-Methylation H3K9me1, Histone, Histone 3 Lysine 9 mono-methylation H4K20me1, Histone, Histone 4 Lysine 20 mono-methylation | |||||||||||||||||||||||||||||||
phyloP / phastCons |
| |||||||||||||||||||||||||||||||
splice sites | splice site change occurs after stopcodon (at aa 246) splice site change occurs after stopcodon (at aa 248)
| |||||||||||||||||||||||||||||||
distance from splice site | 640 | |||||||||||||||||||||||||||||||
Kozak consensus sequence altered? | N/A | |||||||||||||||||||||||||||||||
conservation protein level for non-synonymous changes | N/A | |||||||||||||||||||||||||||||||
protein features | N/A | |||||||||||||||||||||||||||||||
length of protein | N/A | |||||||||||||||||||||||||||||||
AA sequence altered | N/A | |||||||||||||||||||||||||||||||
position of stopcodon in wt / mu CDS | N/A | |||||||||||||||||||||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | |||||||||||||||||||||||||||||||
position of stopcodon in wt / mu cDNA | N/A | |||||||||||||||||||||||||||||||
poly(A) signal | signal is predicted to be ok | |||||||||||||||||||||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | |||||||||||||||||||||||||||||||
position of start ATG in wt / mu cDNA | 368 / 368 | |||||||||||||||||||||||||||||||
chromosome | 12 | |||||||||||||||||||||||||||||||
strand | -1 | |||||||||||||||||||||||||||||||
last intron/exon boundary | 468 | |||||||||||||||||||||||||||||||
theoretical NMD boundary in CDS | 50 | |||||||||||||||||||||||||||||||
length of CDS | 129 | |||||||||||||||||||||||||||||||
coding sequence (CDS) position | N/A | |||||||||||||||||||||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | 1107 | |||||||||||||||||||||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 3229 | |||||||||||||||||||||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 89916811 | |||||||||||||||||||||||||||||||
original gDNA sequence snippet | TGACAGAGTTATGTGCAGAGGTACCTGAGCAAAAAAATTAT | |||||||||||||||||||||||||||||||
altered gDNA sequence snippet | TGACAGAGTTATGTGCAGAGATACCTGAGCAAAAAAATTAT | |||||||||||||||||||||||||||||||
original cDNA sequence snippet | TGACAGAGTTATGTGCAGAGGTACCTGAGCAAAAAAATTAT | |||||||||||||||||||||||||||||||
altered cDNA sequence snippet | TGACAGAGTTATGTGCAGAGATACCTGAGCAAAAAAATTAT | |||||||||||||||||||||||||||||||
wildtype AA sequence | MASATEDPVL ERYFKGHKAA ITSLDLSPNG KQLGKGQADI KN* | |||||||||||||||||||||||||||||||
mutated AA sequence | N/A | |||||||||||||||||||||||||||||||
speed | 1.50 s | |||||||||||||||||||||||||||||||