mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 3.61570111501746e-30 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | ||||||||||||||||||||
Summary |
|
hyperlink | ||||||||||||||||||||
analysed issue | analysis result | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | |||||||||||||||||||||
alteration (phys. location) | chr3:150280445C>GN/A show variant in all transcripts IGV | |||||||||||||||||||||
HGNC symbol | SERP1 | |||||||||||||||||||||
Ensembl transcript ID | ENST00000479209 | |||||||||||||||||||||
Genbank transcript ID | N/A | |||||||||||||||||||||
UniProt peptide | Q9Y6X1 | |||||||||||||||||||||
alteration type | single base exchange | |||||||||||||||||||||
alteration region | intron | |||||||||||||||||||||
DNA changes | g.40571G>C | |||||||||||||||||||||
AA changes | N/A | |||||||||||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | |||||||||||||||||||||
frameshift | N/A | |||||||||||||||||||||
known variant | Reference ID: rs1132979
| |||||||||||||||||||||
regulatory features | H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation | |||||||||||||||||||||
phyloP / phastCons |
| |||||||||||||||||||||
splice sites | splice site change before start ATG (at aa -346) |
| |||||||||||||||||||||
distance from splice site | 15481 | |||||||||||||||||||||
Kozak consensus sequence altered? | N/A | |||||||||||||||||||||
conservation protein level for non-synonymous changes | N/A | |||||||||||||||||||||
protein features |
| |||||||||||||||||||||
length of protein | N/A | |||||||||||||||||||||
AA sequence altered | N/A | |||||||||||||||||||||
position of stopcodon in wt / mu CDS | N/A | |||||||||||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | |||||||||||||||||||||
position of stopcodon in wt / mu cDNA | N/A | |||||||||||||||||||||
poly(A) signal | N/A | |||||||||||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | |||||||||||||||||||||
position of start ATG in wt / mu cDNA | 1274 / 1274 | |||||||||||||||||||||
chromosome | 3 | |||||||||||||||||||||
strand | -1 | |||||||||||||||||||||
last intron/exon boundary | 1434 | |||||||||||||||||||||
theoretical NMD boundary in CDS | 110 | |||||||||||||||||||||
length of CDS | 201 | |||||||||||||||||||||
coding sequence (CDS) position | N/A | |||||||||||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | N/A | |||||||||||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 40571 | |||||||||||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 150280445 | |||||||||||||||||||||
original gDNA sequence snippet | CACTGAGAAAATACTTACTAGTGTAAGGCTGCCACGTTGCC | |||||||||||||||||||||
altered gDNA sequence snippet | CACTGAGAAAATACTTACTACTGTAAGGCTGCCACGTTGCC | |||||||||||||||||||||
original cDNA sequence snippet | N/A | |||||||||||||||||||||
altered cDNA sequence snippet | N/A | |||||||||||||||||||||
wildtype AA sequence | MVAKQRIRMA NEKHSKNITQ RGNVAKTSRN APEEKASVGP WLLALFIFVV CGSAIFQIIQ SIRMGM* | |||||||||||||||||||||
mutated AA sequence | N/A | |||||||||||||||||||||
speed | 0.61 s | |||||||||||||||||||||