mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 4.12139715393132e-32 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | |||||||||||||||
Summary |
|
hyperlink | |||||||||||||||
analysed issue | analysis result | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | ||||||||||||||||
alteration (phys. location) | chr6:42906384G>TN/A show variant in all transcripts IGV | ||||||||||||||||
HGNC symbol | CNPY3 | ||||||||||||||||
Ensembl transcript ID | ENST00000394142 | ||||||||||||||||
Genbank transcript ID | N/A | ||||||||||||||||
UniProt peptide | N/A | ||||||||||||||||
alteration type | single base exchange | ||||||||||||||||
alteration region | 3'UTR | ||||||||||||||||
DNA changes | cDNA.895G>T g.9447G>T | ||||||||||||||||
AA changes | N/A | ||||||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | ||||||||||||||||
frameshift | N/A | ||||||||||||||||
known variant | Reference ID: rs9471969
| ||||||||||||||||
regulatory features | H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation H4K20me1, Histone, Histone 4 Lysine 20 mono-methylation PolII, Polymerase, RNA Polymerase II | ||||||||||||||||
phyloP / phastCons |
| ||||||||||||||||
splice sites |
| ||||||||||||||||
distance from splice site | 79 | ||||||||||||||||
Kozak consensus sequence altered? | N/A | ||||||||||||||||
conservation protein level for non-synonymous changes | N/A | ||||||||||||||||
protein features | N/A | ||||||||||||||||
length of protein | N/A | ||||||||||||||||
AA sequence altered | N/A | ||||||||||||||||
position of stopcodon in wt / mu CDS | N/A | ||||||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | ||||||||||||||||
position of stopcodon in wt / mu cDNA | N/A | ||||||||||||||||
poly(A) signal | signal is predicted to be ok | ||||||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | ||||||||||||||||
position of start ATG in wt / mu cDNA | 328 / 328 | ||||||||||||||||
chromosome | 6 | ||||||||||||||||
strand | 1 | ||||||||||||||||
last intron/exon boundary | 817 | ||||||||||||||||
theoretical NMD boundary in CDS | 439 | ||||||||||||||||
length of CDS | 165 | ||||||||||||||||
coding sequence (CDS) position | N/A | ||||||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | 895 | ||||||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 9447 | ||||||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 42906384 | ||||||||||||||||
original gDNA sequence snippet | GAAGTCCAAGAAGAAGAGCAGCAGGGCCAAGGCAGCAGGCG | ||||||||||||||||
altered gDNA sequence snippet | GAAGTCCAAGAAGAAGAGCATCAGGGCCAAGGCAGCAGGCG | ||||||||||||||||
original cDNA sequence snippet | GAAGTCCAAGAAGAAGAGCAGCAGGGCCAAGGCAGCAGGCG | ||||||||||||||||
altered cDNA sequence snippet | GAAGTCCAAGAAGAAGAGCATCAGGGCCAAGGCAGCAGGCG | ||||||||||||||||
wildtype AA sequence | MDSMPEPASR CLLLLPLLLL LLLLLPAPEL GPSQAGAEEN DWVRLPSKCE GTCG* | ||||||||||||||||
mutated AA sequence | N/A | ||||||||||||||||
speed | 1.35 s | ||||||||||||||||