mutation t@sting

Prediction

polymorphism

Model: without_aae, prob: 1.22195836589048e-19 (classification due to TGP/ExAC, real probability is shown anyway) (explain)

Summary

homozygous in TGP or ExAC
known disease mutation at this position (HGMD CM063843)
protein features (might be) affected
splice site changes

hyperlink

analysed issue

analysis result

name of alteration

no title

alteration (phys. location)

chr14:20925154T>GN/A show variant in all transcripts IGV

HGNC symbol

APEX1

Ensembl transcript ID

ENST00000557054

Genbank transcript ID

N/A

UniProt peptide

P27695

alteration type

single base exchange

alteration region

intron

DNA changes

g.1805T>G

AA changes

N/A

position(s) of altered AA
if AA alteration in CDS

N/A

frameshift

N/A

known variant

Reference ID: rs1130409

database	homozygous (G/G)	heterozygous	allele carriers
1000G	382	1117	1499
ExAC	10968	10831	21799

known disease mutation at this position, please check HGMD for details (HGMD ID CM063843)

regulatory features

H3K4me2, Histone, Histone 3 Lysine 4 Di-Methylation
PolII, Polymerase, RNA Polymerase II
H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation
H3K9me1, Histone, Histone 3 Lysine 9 mono-methylation
H4K20me1, Histone, Histone 4 Lysine 20 mono-methylation

phyloP / phastCons

	PhyloP	PhastCons
(flanking)	2.152	0.969
	-0.483	0.751
(flanking)	5.892	1

explain score(s) and/or inspect your position(s) in in UCSC Genome Browser

splice sites

splice site change before start ATG (at aa -78) |

effect	gDNA position	score	detection sequence	exon-intron border
Acc marginally increased	1800	wt: 0.9892 / mu: 0.9913 (marginal change - not scored)	wt: AATTCTGTTTCATTTCTATAGGCGATGAGGAGCATGATCAG mu: AATTCTGTTTCATTTCTATAGGCGAGGAGGAGCATGATCAG	atag\|GCGA
Acc marginally increased	1795	wt: 0.4893 / mu: 0.5123 (marginal change - not scored)	wt: ATGCTAATTCTGTTTCATTTCTATAGGCGATGAGGAGCATG mu: ATGCTAATTCTGTTTCATTTCTATAGGCGAGGAGGAGCATG	tttc\|TATA
Acc marginally increased	1798	wt: 0.8895 / mu: 0.9204 (marginal change - not scored)	wt: CTAATTCTGTTTCATTTCTATAGGCGATGAGGAGCATGATC mu: CTAATTCTGTTTCATTTCTATAGGCGAGGAGGAGCATGATC	ctat\|AGGC
Acc marginally increased	1797	wt: 0.9186 / mu: 0.9492 (marginal change - not scored)	wt: GCTAATTCTGTTTCATTTCTATAGGCGATGAGGAGCATGAT mu: GCTAATTCTGTTTCATTTCTATAGGCGAGGAGGAGCATGAT	tcta\|TAGG
Acc marginally increased	1799	wt: 0.9467 / mu: 0.9533 (marginal change - not scored)	wt: TAATTCTGTTTCATTTCTATAGGCGATGAGGAGCATGATCA mu: TAATTCTGTTTCATTTCTATAGGCGAGGAGGAGCATGATCA	tata\|GGCG
Donor marginally increased	1802	wt: 0.9736 / mu: 0.9842 (marginal change - not scored)	wt: ATAGGCGATGAGGAG mu: ATAGGCGAGGAGGAG	AGGC\|gatg
Donor increased	1799	wt: 0.23 / mu: 0.99	wt: TCTATAGGCGATGAG mu: TCTATAGGCGAGGAG	TATA\|ggcg
Donor marginally increased	1807	wt: 0.4967 / mu: 0.5311 (marginal change - not scored)	wt: CGATGAGGAGCATGA mu: CGAGGAGGAGCATGA	ATGA\|ggag
Acc gained	1804	0.60	mu: CTGTTTCATTTCTATAGGCGAGGAGGAGCATGATCAGGAAG	gcga\|GGAG

distance from splice site

128

Kozak consensus sequence altered?

N/A

conservation
protein level for non-synonymous changes

N/A

protein features

start (aa)	end (aa)	feature	details
1	1	INIT_MET	Removed.	might get lost (downstream of altered splice site)
2	33	REGION	Necessary for interaction with YBX1, binding to RNA, NPM1-dependent association with rRNA, endoribonuclease activity on abasic RNA and localization in the nucleoli.	might get lost (downstream of altered splice site)
6	6	MUTAGEN	K->R: Lack of acetylation, does not stimulate the YBX1-mediated MDR1 promoter activity and alter nuclear subcellular localization; when associated with R-7. Does not inhibit interaction with HDAC1, HDAC2 and HDAC3. Absence of increase in nCaRE binding activity.	might get lost (downstream of altered splice site)
6	6	MOD_RES	N6-acetyllysine; by EP300.	might get lost (downstream of altered splice site)
7	7	MOD_RES	N6-acetyllysine; by EP300.	might get lost (downstream of altered splice site)
7	7	MUTAGEN	K->R: Lack of acetylation and does not stimulate the YBX1-mediated MDR1 promoter activity and alter nuclear subcellular localization; when associated with R-6.	might get lost (downstream of altered splice site)
8	13	REGION	Nuclear localization signal (NLS).	might get lost (downstream of altered splice site)
12	12	MUTAGEN	E->A: Reduces nuclear localization; when associated with A-13.	might get lost (downstream of altered splice site)
13	13	MUTAGEN	D->A: Reduces nuclear localization; when associated with A-12.	might get lost (downstream of altered splice site)
23	33	REGION	Necessary for interaction with NPM1 and for efficient rRNA binding.	might get lost (downstream of altered splice site)
24	24	MUTAGEN	K->A: Enhances the interaction with TOMM20. Inhibits rRNA binding, interaction with NPM1, nuclear localization and modulates its endodeoxyribonuclease activity; when associated with A-25; A-27; A-31 and A- 32. Inhibits ubiquitination; when associated with K-25 and K-27.	might get lost (downstream of altered splice site)
25	25	MUTAGEN	K->A: Enhances the interaction with TOMM20. Inhibits rRNA binding, interaction with NPM1, nuclear localization and modulates its endodeoxyribonuclease activity; when associated with A-24; A-27; A-31 and A- 32. Inhibits ubiquitination; when associated with K-24 and K-27.	might get lost (downstream of altered splice site)
27	27	MUTAGEN	K->A: Enhances the interaction with TOMM20. Inhibits rRNA binding, interaction with NPM1, nuclear localization and modulates its endodeoyribonuclease activity; when associated with A-24; A-25; A-31 and A- 32. Inhibits ubiquitination; when associated with K-24 and K-25.	might get lost (downstream of altered splice site)
27	27	MOD_RES	N6-acetyllysine.	might get lost (downstream of altered splice site)
31	31	MUTAGEN	K->A: Enhances the interaction with TOMM20. Does not inhibit redox and AP endodeoyribonuclease activities. Inhibits rRNA binding, interaction with NPM1, nuclear localization and modulates its endodeoxyribonuclease activity; when associated with A-24; A-25; A-27 and A- 32. Reduces protection from granzyme A- mediated cell death; when associated with A-65 and A-210.	might get lost (downstream of altered splice site)
31	31	MOD_RES	N6-acetyllysine.	might get lost (downstream of altered splice site)
31	32	SITE	Cleavage; by granzyme A.	might get lost (downstream of altered splice site)
32	32	MUTAGEN	K->A: Inhibits rRNA binding, interaction with NPM1, nuclear localization and modulates its endodeoxyribonuclease activity; when associated with A-24; A- 25; A-27 and A-31.	might get lost (downstream of altered splice site)
32	32	MOD_RES	N6-acetyllysine.	might get lost (downstream of altered splice site)
35	35	MOD_RES	N6-acetyllysine.	might get lost (downstream of altered splice site)
57	57	CONFLICT	G -> A (in Ref. 2; AAA58371).	might get lost (downstream of altered splice site)
62	68	STRAND		might get lost (downstream of altered splice site)
64	80	REGION	Nuclear export signal (NES).	might get lost (downstream of altered splice site)
65	65	DISULFID	Probable.	might get lost (downstream of altered splice site)
65	65	MOD_RES	S-nitrosocysteine.	might get lost (downstream of altered splice site)
65	65	MUTAGEN	C->A: Abolishes the redox activity. Does not abolish the AP endodeoxyribonuclease and phosphodiesterase activities. Reduces protection from granzyme A-mediated cell death; when associated with A-31 and A- 210.	might get lost (downstream of altered splice site)
65	65	MUTAGEN	C->S: Does not abolish NO-induced nitrosylation. Enhances NO-induced nuclear export.	might get lost (downstream of altered splice site)
68	68	METAL	Magnesium or manganese.	might get lost (downstream of altered splice site)
72	77	HELIX		might get lost (downstream of altered splice site)
80	87	HELIX		might get lost (downstream of altered splice site)
90	95	STRAND		might get lost (downstream of altered splice site)
93	93	MUTAGEN	C->S: Does not abolish NO-induced nitrosylation. Abolishes NO-induced nitrosylation and translocation from the nucleus to the cytoplasm; when associated with S-310.	might get lost (downstream of altered splice site)
93	93	DISULFID	Probable.	might get lost (downstream of altered splice site)
93	93	MUTAGEN	C->A: Abolishes partially the redox activity.	might get lost (downstream of altered splice site)
93	93	MOD_RES	S-nitrosocysteine.	might get lost (downstream of altered splice site)
96	96	MUTAGEN	E->A: Lacks MYC CRD RNA cleavage activity.	might get lost (downstream of altered splice site)
96	96	METAL	Magnesium or manganese.	might get lost (downstream of altered splice site)
99	99	MUTAGEN	C->A: Does not abolish the redox activity.	might get lost (downstream of altered splice site)
101	103	HELIX		might get lost (downstream of altered splice site)
106	110	HELIX		might get lost (downstream of altered splice site)
112	114	HELIX		might get lost (downstream of altered splice site)
116	120	STRAND		might get lost (downstream of altered splice site)
122	124	STRAND		might get lost (downstream of altered splice site)
126	128	STRAND		might get lost (downstream of altered splice site)
131	137	STRAND		might get lost (downstream of altered splice site)
138	138	MUTAGEN	C->A: Does not abolish the redox activity.	might get lost (downstream of altered splice site)
140	145	STRAND		might get lost (downstream of altered splice site)
149	151	HELIX		might get lost (downstream of altered splice site)
152	154	STRAND		might get lost (downstream of altered splice site)
157	161	STRAND		might get lost (downstream of altered splice site)
166	171	STRAND		might get lost (downstream of altered splice site)
177	179	HELIX		might get lost (downstream of altered splice site)
182	200	HELIX		might get lost (downstream of altered splice site)
197	197	MOD_RES	N6-acetyllysine.	might get lost (downstream of altered splice site)
205	210	STRAND		might get lost (downstream of altered splice site)
208	208	MUTAGEN	C->A: Does not abolish the redox activity.	might get lost (downstream of altered splice site)
210	210	MUTAGEN	D->A: Abolishes the AP endodeoxyribonuclease activity. Reduces protection from granzyme A-mediated cell death; when associated with A-31 and A- 65.	might get lost (downstream of altered splice site)
210	210	METAL	Magnesium or manganese.	might get lost (downstream of altered splice site)
212	212	METAL	Magnesium or manganese.	might get lost (downstream of altered splice site)
212	212	MUTAGEN	N->A: Abolishes AP endodeoxyribonuclease activity.	might get lost (downstream of altered splice site)
212	212	MUTAGEN	N->Q,D: Decreases AP endodeoxyribonuclease activity.	might get lost (downstream of altered splice site)
217	219	HELIX		might get lost (downstream of altered splice site)
223	225	TURN		might get lost (downstream of altered splice site)
227	229	STRAND		might get lost (downstream of altered splice site)
230	232	TURN		might get lost (downstream of altered splice site)
233	233	MOD_RES	Phosphothreonine; by CDK5 (By similarity).	might get lost (downstream of altered splice site)
234	246	HELIX		might get lost (downstream of altered splice site)
249	251	STRAND		might get lost (downstream of altered splice site)
252	256	HELIX		might get lost (downstream of altered splice site)
257	259	STRAND		might get lost (downstream of altered splice site)
262	262	MOD_RES	Phosphotyrosine.	might get lost (downstream of altered splice site)
270	272	HELIX		might get lost (downstream of altered splice site)
273	276	HELIX		might get lost (downstream of altered splice site)
283	287	STRAND		might get lost (downstream of altered splice site)
289	294	HELIX		might get lost (downstream of altered splice site)
289	318	REGION	Mitochondrial targeting sequence (MTS).	might get lost (downstream of altered splice site)
295	300	STRAND		might get lost (downstream of altered splice site)
296	296	MUTAGEN	C->A: Does not abolish the redox activity.	might get lost (downstream of altered splice site)
299	299	MUTAGEN	K->A: Reduces the interaction with TOMM20. Abolishes localization in the mitochondria; when associated with A-301.	might get lost (downstream of altered splice site)
301	301	MUTAGEN	R->A: Reduces the interaction with TOMM20. Abolishes localization in the mitochondria; when associated with A-299.	might get lost (downstream of altered splice site)
303	303	MUTAGEN	K->A: Reduces the interaction with TOMM20.	might get lost (downstream of altered splice site)
306	306	CONFLICT	G -> A (in Ref. 2; AAA58371).	might get lost (downstream of altered splice site)
306	309	STRAND		might get lost (downstream of altered splice site)
308	308	METAL	Magnesium or manganese.	might get lost (downstream of altered splice site)
309	309	ACT_SITE	Proton acceptor (By similarity).	might get lost (downstream of altered splice site)
309	309	MUTAGEN	H->N: Lacks MYC CRD RNA cleavage activity.	might get lost (downstream of altered splice site)
309	309	METAL	Magnesium or manganese.	might get lost (downstream of altered splice site)
310	310	MOD_RES	S-nitrosocysteine.	might get lost (downstream of altered splice site)
310	310	MUTAGEN	C->A: Does not abolish the redox activity.	might get lost (downstream of altered splice site)
310	310	MUTAGEN	C->S: Does not abolish NO-induced nitrosylation. Abolishes NO-induced nitrosylation and translocation from the nucleus to the cytoplasm; when associated with S-93.	might get lost (downstream of altered splice site)
312	316	STRAND		might get lost (downstream of altered splice site)

length of protein

N/A

AA sequence altered

N/A

position of stopcodon in wt / mu CDS

N/A

position (AA) of stopcodon in wt / mu AA sequence

N/A

position of stopcodon in wt / mu cDNA

N/A

poly(A) signal

N/A

conservation
nucleotide level for all changes - no scoring up to now

N/A

position of start ATG in wt / mu cDNA

480 / 480

chromosome

strand

last intron/exon boundary

244

theoretical NMD boundary in CDS

cannot be calculated, too little distance between start ATG and last intron/exon boundary

length of CDS

150

coding sequence (CDS) position

N/A

cDNA position
(for ins/del: last normal base / first normal base)

N/A

gDNA position
(for ins/del: last normal base / first normal base)

1805

chromosomal position
(for ins/del: last normal base / first normal base)

20925154

original gDNA sequence snippet

TGTTTCATTTCTATAGGCGATGAGGAGCATGATCAGGAAGG

altered gDNA sequence snippet

TGTTTCATTTCTATAGGCGAGGAGGAGCATGATCAGGAAGG

original cDNA sequence snippet

N/A

altered cDNA sequence snippet

N/A

wildtype AA sequence

MMNARSKNVG WRLDYFLLSH SLLPALCDSK IRSKALGSDH CPITLYLAL*

mutated AA sequence

N/A

speed

0.55 s

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project