mutation t@sting

Prediction

polymorphism

Model: without_aae, prob: 1.95261020072041e-24 (classification due to TGP/ExAC, real probability is shown anyway) (explain)

Summary

homozygous in TGP or ExAC
known disease mutation at this position (HGMD CM1613074)
protein features (might be) affected
splice site changes

hyperlink

analysed issue

analysis result

name of alteration

no title

alteration (phys. location)

chr5:55264153C>GN/A show variant in all transcripts IGV

HGNC symbol

IL6ST

Ensembl transcript ID

ENST00000396816

Genbank transcript ID

N/A

UniProt peptide

P40189

alteration type

single base exchange

alteration region

intron

DNA changes

g.26669G>C

AA changes

N/A

position(s) of altered AA
if AA alteration in CDS

N/A

frameshift

N/A

known variant

Reference ID: rs2228044

database	homozygous (G/G)	heterozygous	allele carriers
1000G	182	619	801
ExAC	1673	12702	14375

known disease mutation at this position, please check HGMD for details (HGMD ID CM1613074)

regulatory features

H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation

phyloP / phastCons

	PhyloP	PhastCons
(flanking)	2.965	1
	2.982	1
(flanking)	-0.292	0.969

explain score(s) and/or inspect your position(s) in in UCSC Genome Browser

splice sites

effect	gDNA position	score	wt detection sequence	exon-intron border
Donor increased	26671	wt: 0.23 / mu: 0.57	wt: GATGGTGGAAGGGAA mu: GATCGTGGAAGGGAA	TGGT\|ggaa
Donor marginally increased	26670	wt: 0.5683 / mu: 0.5916 (marginal change - not scored)	wt: GGATGGTGGAAGGGA mu: GGATCGTGGAAGGGA	ATGG\|tgga

distance from splice site

4013

Kozak consensus sequence altered?

N/A

conservation
protein level for non-synonymous changes

N/A

protein features

start (aa)	end (aa)	feature	details
1	22	SIGNAL		might get lost (downstream of altered splice site)
23	619	TOPO_DOM	Extracellular (Potential).	might get lost (downstream of altered splice site)
26	120	DOMAIN	Ig-like C2-type.	might get lost (downstream of altered splice site)
28	28	DISULFID		might get lost (downstream of altered splice site)
28	35	STRAND		might get lost (downstream of altered splice site)
37	39	STRAND		might get lost (downstream of altered splice site)
43	43	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
44	50	STRAND		might get lost (downstream of altered splice site)
48	48	DISULFID		might get lost (downstream of altered splice site)
52	58	HELIX		might get lost (downstream of altered splice site)
54	54	DISULFID		might get lost (downstream of altered splice site)
62	64	HELIX		might get lost (downstream of altered splice site)
65	69	STRAND		might get lost (downstream of altered splice site)
76	78	HELIX		might get lost (downstream of altered splice site)
80	83	STRAND		might get lost (downstream of altered splice site)
83	83	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
86	91	STRAND		might get lost (downstream of altered splice site)
97	107	STRAND		might get lost (downstream of altered splice site)
103	103	DISULFID		might get lost (downstream of altered splice site)
108	110	TURN		might get lost (downstream of altered splice site)
111	123	STRAND		might get lost (downstream of altered splice site)
125	216	DOMAIN	Fibronectin type-III 1.	might get lost (downstream of altered splice site)
130	137	STRAND		might get lost (downstream of altered splice site)
131	131	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
134	134	DISULFID		might get lost (downstream of altered splice site)
143	147	STRAND		might get lost (downstream of altered splice site)
144	144	DISULFID		might get lost (downstream of altered splice site)
157	157	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
157	164	STRAND		might get lost (downstream of altered splice site)
172	172	DISULFID		might get lost (downstream of altered splice site)
176	178	STRAND		might get lost (downstream of altered splice site)
181	183	STRAND		might get lost (downstream of altered splice site)
182	182	DISULFID		might get lost (downstream of altered splice site)
194	202	STRAND		might get lost (downstream of altered splice site)
205	208	STRAND		might get lost (downstream of altered splice site)
212	214	STRAND		might get lost (downstream of altered splice site)
216	218	HELIX		might get lost (downstream of altered splice site)
219	221	STRAND		might get lost (downstream of altered splice site)
222	321	DOMAIN	Fibronectin type-III 2.	might get lost (downstream of altered splice site)
226	231	STRAND		might get lost (downstream of altered splice site)
227	227	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
234	238	STRAND		might get lost (downstream of altered splice site)
240	245	STRAND		might get lost (downstream of altered splice site)
248	251	HELIX		might get lost (downstream of altered splice site)
255	263	STRAND		might get lost (downstream of altered splice site)
274	277	HELIX		might get lost (downstream of altered splice site)
282	286	STRAND		might get lost (downstream of altered splice site)
291	303	STRAND		might get lost (downstream of altered splice site)
310	314	MOTIF	WSXWS motif.	might get lost (downstream of altered splice site)
317	321	STRAND		might get lost (downstream of altered splice site)
325	331	HELIX		might get lost (downstream of altered splice site)
326	418	DOMAIN	Fibronectin type-III 3.	might get lost (downstream of altered splice site)
332	338	STRAND		might get lost (downstream of altered splice site)
345	351	STRAND		might get lost (downstream of altered splice site)
356	359	HELIX		might get lost (downstream of altered splice site)
363	372	STRAND		might get lost (downstream of altered splice site)
378	391	STRAND		might get lost (downstream of altered splice site)
379	379	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
383	383	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
390	390	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
396	406	STRAND		might get lost (downstream of altered splice site)
412	416	STRAND		might get lost (downstream of altered splice site)
423	514	DOMAIN	Fibronectin type-III 4.	might get lost (downstream of altered splice site)
428	435	STRAND		might get lost (downstream of altered splice site)
438	444	STRAND		might get lost (downstream of altered splice site)
452	460	STRAND		might get lost (downstream of altered splice site)
458	458	DISULFID		might get lost (downstream of altered splice site)
462	464	STRAND		might get lost (downstream of altered splice site)
466	466	DISULFID		might get lost (downstream of altered splice site)
469	474	STRAND		might get lost (downstream of altered splice site)
478	481	STRAND		might get lost (downstream of altered splice site)
491	500	STRAND		might get lost (downstream of altered splice site)
508	515	STRAND		might get lost (downstream of altered splice site)
518	610	DOMAIN	Fibronectin type-III 5.	might get lost (downstream of altered splice site)
525	530	STRAND		might get lost (downstream of altered splice site)
535	539	STRAND		might get lost (downstream of altered splice site)
544	547	HELIX		might get lost (downstream of altered splice site)
553	553	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
553	560	STRAND		might get lost (downstream of altered splice site)
564	564	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
566	571	STRAND		might get lost (downstream of altered splice site)
575	579	STRAND		might get lost (downstream of altered splice site)
587	596	STRAND		might get lost (downstream of altered splice site)
599	602	STRAND		might get lost (downstream of altered splice site)
606	609	STRAND		might get lost (downstream of altered splice site)
620	641	TRANSMEM	Helical; (Potential).	might get lost (downstream of altered splice site)
642	918	TOPO_DOM	Cytoplasmic (Potential).	might get lost (downstream of altered splice site)
651	659	MOTIF	Box 1 motif.	might get lost (downstream of altered splice site)
667	667	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
725	755	COMPBIAS	Ser-rich.	might get lost (downstream of altered splice site)
782	782	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
782	782	MUTAGEN	S->A: Increases cell surface expression.	might get lost (downstream of altered splice site)
820	820	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
829	829	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)

length of protein

N/A

AA sequence altered

N/A

position of stopcodon in wt / mu CDS

N/A

position (AA) of stopcodon in wt / mu AA sequence

N/A

position of stopcodon in wt / mu cDNA

N/A

poly(A) signal

N/A

conservation
nucleotide level for all changes - no scoring up to now

N/A

position of start ATG in wt / mu cDNA

1 / 1

chromosome

strand

-1

last intron/exon boundary

theoretical NMD boundary in CDS

length of CDS

168

coding sequence (CDS) position

N/A

cDNA position
(for ins/del: last normal base / first normal base)

N/A

gDNA position
(for ins/del: last normal base / first normal base)

26669

chromosomal position
(for ins/del: last normal base / first normal base)

55264153

original gDNA sequence snippet

AAATGAGGTGTGAGTGGGATGGTGGAAGGGAAACACACTTG

altered gDNA sequence snippet

AAATGAGGTGTGAGTGGGATCGTGGAAGGGAAACACACTTG

original cDNA sequence snippet

N/A

altered cDNA sequence snippet

N/A

wildtype AA sequence

MLTLQTWLVQ ALFIFLTTES TGQHTSLLIA KQNVTPPPHA LLIILLCILS TLKSG*

mutated AA sequence

N/A

speed

0.76 s

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project