mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 0.999999882116632 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | ||||||||||||
Summary |
|
hyperlink | ||||||||||||
analysed issue | analysis result | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | |||||||||||||
alteration (phys. location) | chr17:71232687T>CN/A show variant in all transcripts IGV | |||||||||||||
HGNC symbol | C17orf80 | |||||||||||||
Ensembl transcript ID | ENST00000582793 | |||||||||||||
Genbank transcript ID | N/A | |||||||||||||
UniProt peptide | N/A | |||||||||||||
alteration type | single base exchange | |||||||||||||
alteration region | intron | |||||||||||||
DNA changes | g.4316T>C | |||||||||||||
AA changes | N/A | |||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | |||||||||||||
frameshift | N/A | |||||||||||||
known variant | Reference ID: rs745143
| |||||||||||||
regulatory features | H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation H3K9me1, Histone, Histone 3 Lysine 9 mono-methylation | |||||||||||||
phyloP / phastCons |
| |||||||||||||
splice sites |
| |||||||||||||
distance from splice site | 3223 | |||||||||||||
Kozak consensus sequence altered? | N/A | |||||||||||||
conservation protein level for non-synonymous changes | N/A | |||||||||||||
protein features | N/A | |||||||||||||
length of protein | N/A | |||||||||||||
AA sequence altered | N/A | |||||||||||||
position of stopcodon in wt / mu CDS | N/A | |||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | |||||||||||||
position of stopcodon in wt / mu cDNA | N/A | |||||||||||||
poly(A) signal | N/A | |||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | |||||||||||||
position of start ATG in wt / mu cDNA | 181 / 181 | |||||||||||||
chromosome | 17 | |||||||||||||
strand | 1 | |||||||||||||
last intron/exon boundary | 317 | |||||||||||||
theoretical NMD boundary in CDS | 86 | |||||||||||||
length of CDS | 237 | |||||||||||||
coding sequence (CDS) position | N/A | |||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | N/A | |||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 4316 | |||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 71232687 | |||||||||||||
original gDNA sequence snippet | AAAGACCACATTTAAGTTTGTTCATTCCGAGGGAGACGACT | |||||||||||||
altered gDNA sequence snippet | AAAGACCACATTTAAGTTTGCTCATTCCGAGGGAGACGACT | |||||||||||||
original cDNA sequence snippet | N/A | |||||||||||||
altered cDNA sequence snippet | N/A | |||||||||||||
wildtype AA sequence | MRLLGAVQKG WIRCNTTIRK SGFGGITMLF TGYFVLCCSW SFRRLKKLCR PLPWKSTVPP CIGVAKTTGD CRSKTCLD* | |||||||||||||
mutated AA sequence | N/A | |||||||||||||
speed | 0.92 s | |||||||||||||