Prediction |
polymorphism |
Model: without_aae, prob: 3.79118509373519e-21 (classification due to TGP/ExAC,
real probability is shown anyway)
(explain) |
| Summary |
- homozygous in TGP or ExAC
- protein features (might be) affected
- splice site changes
|
hyperlink |
| analysed issue |
analysis result |
| name of alteration | no title |
| alteration (phys. location) | chr3:75786684G>TN/A
show variant in all transcripts IGV
|
| HGNC symbol | ZNF717 |
| Ensembl transcript ID | ENST00000477374 |
| Genbank transcript ID | N/A |
| UniProt peptide | Q9BY31 |
| alteration type | single base exchange |
| alteration region | intron |
| DNA changes | g.48051C>A |
| AA changes | N/A |
position(s) of altered AA
if AA alteration in CDS | N/A |
| frameshift | N/A |
| known variant | Reference ID: rs201345045
| database | homozygous (T/T) | heterozygous | allele carriers |
| 1000G | - | - | - |
| ExAC | 575 | 4107 | 4682 |
|
| regulatory features | Gene Associated, Regulatory Feature, Gene associated regulatory feature
H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation
H3K9me3, Histone, Histone 3 Lysine 9 Tri-Methylation
H4K20me3, Histone, Histone 4 Lysine 20 Tri-Methylation
ZNF274, Transcription Factor, ZNF274 Transcription Factor Binding |
| phyloP / phastCons | | PhyloP | PhastCons |
| (flanking) | 3.196 | 1 | | 2.419 | 1 | | (flanking) | 3.196 | 1 |
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser |
| splice sites | | effect | gDNA position | score | wt detection sequence | exon-intron border | | Donor marginally increased | 48056 | wt: 0.9532 / mu: 0.9607 (marginal change - not scored) | wt: CACCGGGGAAAAGCC
mu: AACCGGGGAAAAGCC | CCGG|ggaa | | Donor marginally increased | 48054 | wt: 0.6716 / mu: 0.7296 (marginal change - not scored) | wt: CACACCGGGGAAAAG
mu: CAAACCGGGGAAAAG | CACC|gggg | | Donor increased | 48046 | wt: 0.35 / mu: 0.83 | wt: AGAGAACTCACACCG
mu: AGAGAACTCAAACCG | AGAA|ctca | | Donor marginally increased | 48055 | wt: 0.9507 / mu: 0.9670 (marginal change - not scored) | wt: ACACCGGGGAAAAGC
mu: AAACCGGGGAAAAGC | ACCG|ggga |
|
| distance from splice site | 3743 |
| Kozak consensus sequence altered? | N/A |
conservation
protein level for non-synonymous changes | N/A |
| protein features | | start (aa) | end (aa) | feature | details | | | 202 | 224 | ZN_FING | C2H2-type 1; degenerate. | might get lost (downstream of altered splice site) | | 259 | 270 | ZN_FING | C2H2-type 2; degenerate. | might get lost (downstream of altered splice site) | | 276 | 298 | ZN_FING | C2H2-type 3; degenerate. | might get lost (downstream of altered splice site) | | 304 | 326 | ZN_FING | C2H2-type 4. | might get lost (downstream of altered splice site) | | 332 | 354 | ZN_FING | C2H2-type 5. | might get lost (downstream of altered splice site) | | 360 | 382 | ZN_FING | C2H2-type 6. | might get lost (downstream of altered splice site) | | 388 | 410 | ZN_FING | C2H2-type 7. | might get lost (downstream of altered splice site) | | 391 | 391 | MOD_RES | Phosphoserine. | might get lost (downstream of altered splice site) | | 396 | 396 | MOD_RES | Phosphothreonine. | might get lost (downstream of altered splice site) | | 398 | 398 | MOD_RES | Phosphoserine. | might get lost (downstream of altered splice site) | | 402 | 402 | MOD_RES | Phosphotyrosine. | might get lost (downstream of altered splice site) | | 416 | 438 | ZN_FING | C2H2-type 8. | might get lost (downstream of altered splice site) | | 444 | 466 | ZN_FING | C2H2-type 9. | might get lost (downstream of altered splice site) | | 472 | 494 | ZN_FING | C2H2-type 10. | might get lost (downstream of altered splice site) | | 500 | 522 | ZN_FING | C2H2-type 11. | might get lost (downstream of altered splice site) | | 528 | 550 | ZN_FING | C2H2-type 12. | might get lost (downstream of altered splice site) | | 556 | 578 | ZN_FING | C2H2-type 13. | might get lost (downstream of altered splice site) | | 584 | 606 | ZN_FING | C2H2-type 14. | might get lost (downstream of altered splice site) | | 612 | 634 | ZN_FING | C2H2-type 15. | might get lost (downstream of altered splice site) | | 642 | 659 | ZN_FING | C2H2-type 16; degenerate. | might get lost (downstream of altered splice site) | | 664 | 664 | CONFLICT | R -> H (in Ref. 2; AAK28319). | might get lost (downstream of altered splice site) | | 731 | 742 | ZN_FING | C2H2-type 17; degenerate. | might get lost (downstream of altered splice site) | | 748 | 770 | ZN_FING | C2H2-type 18. | might get lost (downstream of altered splice site) | | 776 | 798 | ZN_FING | C2H2-type 19. | might get lost (downstream of altered splice site) | | 804 | 826 | ZN_FING | C2H2-type 20. | might get lost (downstream of altered splice site) | | 832 | 854 | ZN_FING | C2H2-type 21. | might get lost (downstream of altered splice site) | | 860 | 882 | ZN_FING | C2H2-type 22. | might get lost (downstream of altered splice site) |
|
| length of protein | N/A |
| AA sequence altered | N/A |
| position of stopcodon in wt / mu CDS | N/A |
| position (AA) of stopcodon in wt / mu AA sequence | N/A |
| position of stopcodon in wt / mu cDNA | N/A |
| poly(A) signal | N/A |
conservation
nucleotide level for all changes - no scoring up to now | N/A |
| position of start ATG in wt / mu cDNA | 173 / 173 |
| chromosome | 3 |
| strand | -1 |
| last intron/exon boundary | 512 |
| theoretical NMD boundary in CDS | 289 |
| length of CDS | 345 |
| coding sequence (CDS) position | N/A |
cDNA position
(for ins/del: last normal base / first normal base) | N/A |
gDNA position
(for ins/del: last normal base / first normal base) | 48051 |
chromosomal position
(for ins/del: last normal base / first normal base) | 75786684 |
| original gDNA sequence snippet | ATTATACATCAGAGAACTCACACCGGGGAAAAGCCCTATGA |
| altered gDNA sequence snippet | ATTATACATCAGAGAACTCAAACCGGGGAAAAGCCCTATGA |
| original cDNA sequence snippet | N/A |
| altered cDNA sequence snippet | N/A |
| wildtype AA sequence | MFPVFSGCFQ ELQEKNKSLE LVSFEEVAVH FTWEEWQDLD DAQRTLYRDV MLETYSSLVS
LGHYITKPEM IFKLEQGAEP WIVEETPNLR LSGGSKKQVF SGICHRSLVE LQEV* |
| mutated AA sequence | N/A |
| speed | 0.72 s |
|
|
