mutation t@sting

documentation

Prediction

disease causing

Model: without_aae, prob: 1 (classification due to ClinVar, real probability is shown anyway) (explain)

Summary

known disease mutation at this position (HGMD CM980216)
known disease mutation: rs37392 (pathogenic)
protein features (might be) affected
splice site changes

hyperlink

analysed issue

analysis result

name of alteration

no title

alteration (phys. location)

chr17:41267761C>TN/A show variant in all transcripts IGV

HGNC symbol

BRCA1

Ensembl transcript ID

ENST00000586385

Genbank transcript ID

N/A

UniProt peptide

P38398

alteration type

single base exchange

alteration region

intron

DNA changes

g.54530G>A

AA changes

N/A

position(s) of altered AA
if AA alteration in CDS

N/A

frameshift

N/A

known variant

Reference ID: rs80357498
Allele 'T' was neither found in ExAC nor 1000G.
known disease mutation: rs37392 (pathogenic for Breast neoplasm|Hereditary breast and ovarian cancer syndrome|Breast-ovarian cancer, familial 1|Hereditary cancer-predisposing syndrome|not provided) dbSNP NCBI variation viewer
known disease mutation at this position, please check HGMD for details (HGMD ID CM980216)

known disease mutation at this position, please check HGMD for details (HGMD ID CM980216)
known disease mutation at this position, please check HGMD for details (HGMD ID CM980216)

regulatory features

H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation

phyloP / phastCons

	PhyloP	PhastCons
(flanking)	0.915	1
	3.453	1
(flanking)	2.902	0.975

explain score(s) and/or inspect your position(s) in in UCSC Genome Browser

splice sites

effect	gDNA position	score	wt detection sequence	exon-intron border
Donor gained	54526	0.64	mu: CCACAAAGTATGACC	ACAA\|agta

distance from splice site

9438

Kozak consensus sequence altered?

N/A

conservation
protein level for non-synonymous changes

N/A

protein features

start (aa)	end (aa)	feature	details
3	5	HELIX		might get lost (downstream of altered splice site)
8	21	HELIX		might get lost (downstream of altered splice site)
24	65	ZN_FING	RING-type.	might get lost (downstream of altered splice site)
25	27	STRAND		might get lost (downstream of altered splice site)
26	26	MUTAGEN	I->A: Disrupts the interaction with E2 enzymes, thereby abolishing the E3 ubiquitin-protein ligase activity.	might get lost (downstream of altered splice site)
26	26	MUTAGEN	I->E: No ubiquitination of RBBP8. No restoration RBBP8-mediated focus formation or G2/M checkpoint control upon DNA damage.	might get lost (downstream of altered splice site)
46	53	HELIX		might get lost (downstream of altered splice site)
54	58	STRAND		might get lost (downstream of altered splice site)
62	64	TURN		might get lost (downstream of altered splice site)
70	72	TURN		might get lost (downstream of altered splice site)
71	71	MUTAGEN	R->G: No effect on interaction with BAP1.	might get lost (downstream of altered splice site)
78	80	STRAND		might get lost (downstream of altered splice site)
81	96	HELIX		might get lost (downstream of altered splice site)
89	89	CONFLICT	I -> T (in Ref. 4; AAB61673).	might get lost (downstream of altered splice site)
148	148	CONFLICT	Missing (in Ref. 4; AAB61673).	might get lost (downstream of altered splice site)
253	253	CONFLICT	A -> V (in Ref. 3; AAC00049).	might get lost (downstream of altered splice site)
308	308	MOD_RES	Phosphoserine; by AURKA.	might get lost (downstream of altered splice site)
308	308	MUTAGEN	S->N: Abolishes phosphorylation by AURKA and interferes with cell cycle progression from G2 to mitosis.	might get lost (downstream of altered splice site)
395	395	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
398	398	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
403	403	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
651	654	COMPBIAS	Poly-Lys.	might get lost (downstream of altered splice site)
753	753	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
840	840	MOD_RES	Phosphoserine (By similarity).	might get lost (downstream of altered splice site)
988	988	MOD_RES	Phosphoserine; by CHEK2.	might get lost (downstream of altered splice site)
1077	1077	CONFLICT	G -> R (in Ref. 4; AAB61673).	might get lost (downstream of altered splice site)
1143	1143	MUTAGEN	S->A: Reduces in vitro phosphorylation by ATR.	might get lost (downstream of altered splice site)
1143	1143	MOD_RES	Phosphoserine; by ATR; in vitro.	might get lost (downstream of altered splice site)
1211	1211	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
1212	1212	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
1217	1217	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
1218	1218	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
1239	1239	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
1239	1239	MUTAGEN	S->A: No effect on in vitro phosphorylation by ATR.	might get lost (downstream of altered splice site)
1245	1245	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
1280	1280	MOD_RES	Phosphoserine; by ATR; in vitro.	might get lost (downstream of altered splice site)
1280	1280	MUTAGEN	S->A: Reduces in vitro phosphorylation by ATR.	might get lost (downstream of altered splice site)
1298	1298	MUTAGEN	S->A: No effect on in vitro phosphorylation by ATR.	might get lost (downstream of altered splice site)
1330	1330	MUTAGEN	S->A: No effect on in vitro phosphorylation by ATR.	might get lost (downstream of altered splice site)
1330	1330	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
1336	1336	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
1342	1342	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
1387	1387	MOD_RES	Phosphoserine; by ATM and ATR.	might get lost (downstream of altered splice site)
1387	1387	MUTAGEN	S->A: Loss of IR-induced S-phase checkpoint. Reduces in vitro phosphorylation by ATR.	might get lost (downstream of altered splice site)
1394	1394	MOD_RES	Phosphothreonine; by ATR; in vitro.	might get lost (downstream of altered splice site)
1394	1394	MUTAGEN	T->A: Reduces in vitro phosphorylation by ATR.	might get lost (downstream of altered splice site)
1397	1424	REGION	Interaction with PALB2.	might get lost (downstream of altered splice site)
1423	1423	MOD_RES	Phosphoserine; by ATM and ATR.	might get lost (downstream of altered splice site)
1423	1423	MUTAGEN	S->A: Inhibition of the infrared-induced G2 arrest. Reduces phosphorylation by ATR.	might get lost (downstream of altered splice site)
1426	1426	CONFLICT	S -> P (in Ref. 3; AAC00049).	might get lost (downstream of altered splice site)
1453	1453	CONFLICT	Missing (in Ref. 3; AAC00049).	might get lost (downstream of altered splice site)
1457	1457	MUTAGEN	S->A: Reduces in vitro phosphorylation by ATR.	might get lost (downstream of altered splice site)
1457	1457	MOD_RES	Phosphoserine; by ATR; in vitro.	might get lost (downstream of altered splice site)
1466	1466	MUTAGEN	S->A: No effect on in vitro phosphorylation by ATR.	might get lost (downstream of altered splice site)
1466	1466	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
1524	1524	MUTAGEN	S->A: No change in infrared S-phase delay; when associated with A-1387. No effect on in vitro phosphorylation by ATR.	might get lost (downstream of altered splice site)
1524	1524	MOD_RES	Phosphoserine; by ATM.	might get lost (downstream of altered splice site)
1542	1542	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
1642	1736	DOMAIN	BRCT 1.	might get lost (downstream of altered splice site)
1651	1656	STRAND		might get lost (downstream of altered splice site)
1655	1655	MUTAGEN	S->A: Abolishes interaction with BRIP1.	might get lost (downstream of altered splice site)
1659	1672	HELIX		might get lost (downstream of altered splice site)
1675	1679	STRAND		might get lost (downstream of altered splice site)
1686	1689	STRAND		might get lost (downstream of altered splice site)
1695	1697	STRAND		might get lost (downstream of altered splice site)
1700	1700	MOD_RES	Phosphothreonine.	might get lost (downstream of altered splice site)
1701	1708	HELIX		might get lost (downstream of altered splice site)
1702	1702	MUTAGEN	K->M: Abolishes interaction with BRIP1.	might get lost (downstream of altered splice site)
1712	1715	STRAND		might get lost (downstream of altered splice site)
1717	1724	HELIX		might get lost (downstream of altered splice site)
1720	1720	MUTAGEN	T->A: No effect on in vitro phosphorylation by ATR.	might get lost (downstream of altered splice site)
1720	1720	MOD_RES	Phosphothreonine.	might get lost (downstream of altered splice site)
1725	1727	STRAND		might get lost (downstream of altered splice site)
1731	1734	HELIX		might get lost (downstream of altered splice site)
1738	1738	MUTAGEN	G->E: Abolishes interaction with BRIP1.	might get lost (downstream of altered splice site)
1740	1742	TURN		might get lost (downstream of altered splice site)
1743	1745	STRAND		might get lost (downstream of altered splice site)
1748	1753	HELIX		might get lost (downstream of altered splice site)
1755	1755	MUTAGEN	S->A: No effect on in vitro phosphorylation by ATR.	might get lost (downstream of altered splice site)
1755	1757	TURN		might get lost (downstream of altered splice site)
1756	1855	DOMAIN	BRCT 2.	might get lost (downstream of altered splice site)
1760	1763	TURN		might get lost (downstream of altered splice site)
1765	1768	STRAND		might get lost (downstream of altered splice site)
1770	1772	STRAND		might get lost (downstream of altered splice site)
1773	1775	STRAND		might get lost (downstream of altered splice site)
1777	1786	HELIX		might get lost (downstream of altered splice site)
1789	1791	STRAND		might get lost (downstream of altered splice site)
1795	1797	HELIX		might get lost (downstream of altered splice site)
1801	1803	STRAND		might get lost (downstream of altered splice site)
1806	1810	STRAND		might get lost (downstream of altered splice site)
1812	1814	HELIX		might get lost (downstream of altered splice site)
1819	1822	HELIX		might get lost (downstream of altered splice site)
1825	1827	TURN		might get lost (downstream of altered splice site)
1828	1830	STRAND		might get lost (downstream of altered splice site)
1832	1834	STRAND		might get lost (downstream of altered splice site)
1835	1844	HELIX		might get lost (downstream of altered splice site)
1851	1853	HELIX		might get lost (downstream of altered splice site)

length of protein

N/A

AA sequence altered

N/A

position of stopcodon in wt / mu CDS

N/A

position (AA) of stopcodon in wt / mu AA sequence

N/A

position of stopcodon in wt / mu cDNA

N/A

poly(A) signal

N/A

conservation
nucleotide level for all changes - no scoring up to now

N/A

position of start ATG in wt / mu cDNA

145 / 145

chromosome

strand

-1

last intron/exon boundary

542

theoretical NMD boundary in CDS

347

length of CDS

522

coding sequence (CDS) position

N/A

cDNA position
(for ins/del: last normal base / first normal base)

N/A

gDNA position
(for ins/del: last normal base / first normal base)

54530

chromosomal position
(for ins/del: last normal base / first normal base)

41267761

original gDNA sequence snippet

GGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAGT

altered gDNA sequence snippet

GGAACCTGTCTCCACAAAGTATGACCACATATTTTGCAAGT

original cDNA sequence snippet

N/A

altered cDNA sequence snippet

N/A

wildtype AA sequence

MDAEFVCERT LKYFLGIAGG KWVVSYFWVT QSIKERKMLN EHDFEVRGDV VNGRNHQGPK
RARESQDRKI FRGLEICCYG PFTNMPTDQL EWMVQLCGAS VVKELSSFTL GTGVHPIVVV
QPDAWTEDNG FHAIGQMCEA PVVTREWVLD SVALYQCQEL DTYLIPQIPH SHY*

mutated AA sequence

N/A

speed

0.88 s

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project