|
|
mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 0.999999303850982 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | ||||||||||||
| Summary |
|
hyperlink | ||||||||||||
| analysed issue | analysis result | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| name of alteration | no title | |||||||||||||
| alteration (phys. location) | chr1:178489978T>GN/A show variant in all transcripts IGV | |||||||||||||
| HGNC symbol | TEX35 | |||||||||||||
| Ensembl transcript ID | ENST00000367642 | |||||||||||||
| Genbank transcript ID | N/A | |||||||||||||
| UniProt peptide | N/A | |||||||||||||
| alteration type | single base exchange | |||||||||||||
| alteration region | 3'UTR | |||||||||||||
| DNA changes | cDNA.647T>G g.7767T>G | |||||||||||||
| AA changes | N/A | |||||||||||||
| position(s) of altered AA if AA alteration in CDS | N/A | |||||||||||||
| frameshift | N/A | |||||||||||||
| known variant | Reference ID: rs3813636
| |||||||||||||
| regulatory features | H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation | |||||||||||||
| phyloP / phastCons |
| |||||||||||||
| splice sites | no abrogation of potential splice sites | |||||||||||||
| distance from splice site | 327 | |||||||||||||
| Kozak consensus sequence altered? | N/A | |||||||||||||
| conservation protein level for non-synonymous changes | N/A | |||||||||||||
| protein features | N/A | |||||||||||||
| length of protein | N/A | |||||||||||||
| AA sequence altered | N/A | |||||||||||||
| position of stopcodon in wt / mu CDS | N/A | |||||||||||||
| position (AA) of stopcodon in wt / mu AA sequence | N/A | |||||||||||||
| position of stopcodon in wt / mu cDNA | N/A | |||||||||||||
| poly(A) signal | signal is predicted to be ok | |||||||||||||
| conservation nucleotide level for all changes - no scoring up to now | N/A | |||||||||||||
| position of start ATG in wt / mu cDNA | 72 / 72 | |||||||||||||
| chromosome | 1 | |||||||||||||
| strand | 1 | |||||||||||||
| last intron/exon boundary | 321 | |||||||||||||
| theoretical NMD boundary in CDS | 199 | |||||||||||||
| length of CDS | 300 | |||||||||||||
| coding sequence (CDS) position | N/A | |||||||||||||
| cDNA position (for ins/del: last normal base / first normal base) | 647 | |||||||||||||
| gDNA position (for ins/del: last normal base / first normal base) | 7767 | |||||||||||||
| chromosomal position (for ins/del: last normal base / first normal base) | 178489978 | |||||||||||||
| original gDNA sequence snippet | AAAAACAAAACAGGGCTCACTGGATCCCCTTCATCACTGTG | |||||||||||||
| altered gDNA sequence snippet | AAAAACAAAACAGGGCTCACGGGATCCCCTTCATCACTGTG | |||||||||||||
| original cDNA sequence snippet | AAAAACAAAACAGGGCTCACTGGATCCCCTTCATCACTGTG | |||||||||||||
| altered cDNA sequence snippet | AAAAACAAAACAGGGCTCACGGGATCCCCTTCATCACTGTG | |||||||||||||
| wildtype AA sequence | MSAKRAELKK THLSKNYKAV CLELKPEPTK VRSPFEAMQA ARPEIHGEVT RSQGSFADPS GQDLSQTFDY KAVKQEGRFT KAGRTPRLLE ELSLLLLPL* | |||||||||||||
| mutated AA sequence | N/A | |||||||||||||
| speed | 0.27 s | |||||||||||||