mutation t@sting

Prediction

disease causing

Model: simple_aae, prob: 0.985948893046432 (classification due to ClinVar, real probability is shown anyway) (explain)

Summary

amino acid sequence changed
known disease mutation at this position (HGMD CM044587)
known disease mutation: rs16551 (pathogenic)
protein features (might be) affected
splice site changes

hyperlink

analysed issue

analysis result

name of alteration

no title

alteration (phys. location)

chr1:196659324T>AN/A show variant in all transcripts IGV

HGNC symbol

CFH

Ensembl transcript ID

ENST00000359637

Genbank transcript ID

N/A

UniProt peptide

P08603

alteration type

single base exchange

alteration region

CDS

DNA changes

c.1099T>A
cDNA.1161T>A
g.38317T>A

AA changes

C367S Score: 112 explain score(s)

position(s) of altered AA
if AA alteration in CDS

367

frameshift

known variant

Reference ID: rs121913056
Allele 'A' was neither found in ExAC nor 1000G.
known disease mutation: rs16551 (pathogenic for Factor H deficiency) dbSNP NCBI variation viewer
known disease mutation at this position, please check HGMD for details (HGMD ID CM044587)

known disease mutation at this position, please check HGMD for details (HGMD ID CM044587)
known disease mutation at this position, please check HGMD for details (HGMD ID CM044587)

regulatory features

H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation

phyloP / phastCons

	PhyloP	PhastCons
(flanking)	-1.923	0.002
	2.425	0.826
(flanking)	2.867	0.871

explain score(s) and/or inspect your position(s) in in UCSC Genome Browser

splice sites

effect	gDNA position	score	wt detection sequence	exon-intron border
Donor marginally increased	38321	wt: 0.4818 / mu: 0.4894 (marginal change - not scored)	wt: ATGTATGGAGAATGG mu: AAGTATGGAGAATGG	GTAT\|ggag
Donor increased	38322	wt: 0.56 / mu: 0.81	wt: TGTATGGAGAATGGC mu: AGTATGGAGAATGGC	TATG\|gaga
Donor increased	38319	wt: 0.39 / mu: 0.52	wt: ACATGTATGGAGAAT mu: ACAAGTATGGAGAAT	ATGT\|atgg
Donor marginally increased	38310	wt: 0.9514 / mu: 0.9566 (marginal change - not scored)	wt: ACCACAGTTACATGT mu: ACCACAGTTACAAGT	CACA\|gtta
Donor increased	38316	wt: 0.21 / mu: 0.31	wt: GTTACATGTATGGAG mu: GTTACAAGTATGGAG	TACA\|tgta
Donor increased	38312	wt: 0.80 / mu: 0.97	wt: CACAGTTACATGTAT mu: CACAGTTACAAGTAT	CAGT\|taca
Donor gained	38317	0.71	mu: TTACAAGTATGGAGA	ACAA\|gtat

distance from splice site

Kozak consensus sequence altered?

N/A

conservation
protein level for non-synonymous changes

species

match

gene

alignment

Human

367

mutated

not conserved

367

Ptroglodytes

all identical

ENSPTRG00000001799

431

Mmulatta

no homologue

Fcatus

no homologue

Mmusculus

all identical

ENSMUSG00000026365

449

Ggallus

no homologue

Trubripes

no homologue

Drerio

all identical

ENSDARG00000092786

227

Dmelanogaster

no homologue

Celegans

no homologue

Xtropicalis

no homologue

protein features

start (aa)	end (aa)	feature	details
324	386	DOMAIN	Sushi 6.	lost
366	375	STRAND		lost
374	374	DISULFID	By similarity.	might get lost (downstream of altered splice site)
378	383	STRAND		might get lost (downstream of altered splice site)
385	385	DISULFID	By similarity.	might get lost (downstream of altered splice site)
386	390	STRAND		might get lost (downstream of altered splice site)
387	444	DOMAIN	Sushi 7.	might get lost (downstream of altered splice site)
389	389	DISULFID	By similarity.	might get lost (downstream of altered splice site)
400	403	TURN		might get lost (downstream of altered splice site)
405	407	STRAND		might get lost (downstream of altered splice site)
411	413	STRAND		might get lost (downstream of altered splice site)
415	417	STRAND		might get lost (downstream of altered splice site)
416	416	DISULFID	By similarity.	might get lost (downstream of altered splice site)
420	422	STRAND		might get lost (downstream of altered splice site)
423	425	STRAND		might get lost (downstream of altered splice site)
427	432	STRAND		might get lost (downstream of altered splice site)
431	431	DISULFID	By similarity.	might get lost (downstream of altered splice site)
435	438	STRAND		might get lost (downstream of altered splice site)
442	442	DISULFID	By similarity.	might get lost (downstream of altered splice site)
446	507	DOMAIN	Sushi 8.	might get lost (downstream of altered splice site)
447	449	STRAND		might get lost (downstream of altered splice site)
448	448	DISULFID	By similarity.	might get lost (downstream of altered splice site)
450	452	HELIX		might get lost (downstream of altered splice site)
456	459	STRAND		might get lost (downstream of altered splice site)
465	468	STRAND		might get lost (downstream of altered splice site)
472	477	STRAND		might get lost (downstream of altered splice site)
477	477	DISULFID	By similarity.	might get lost (downstream of altered splice site)
484	486	STRAND		might get lost (downstream of altered splice site)
488	495	STRAND		might get lost (downstream of altered splice site)
494	494	DISULFID	By similarity.	might get lost (downstream of altered splice site)
498	500	STRAND		might get lost (downstream of altered splice site)
505	505	DISULFID	By similarity.	might get lost (downstream of altered splice site)
509	509	DISULFID	By similarity.	might get lost (downstream of altered splice site)
515	566	DOMAIN	Sushi 9.	might get lost (downstream of altered splice site)
529	529	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
536	536	DISULFID	By similarity.	might get lost (downstream of altered splice site)
553	553	DISULFID	By similarity.	might get lost (downstream of altered splice site)
564	564	DISULFID	By similarity.	might get lost (downstream of altered splice site)
567	625	DOMAIN	Sushi 10.	might get lost (downstream of altered splice site)
569	569	DISULFID	By similarity.	might get lost (downstream of altered splice site)
597	597	DISULFID	By similarity.	might get lost (downstream of altered splice site)
611	611	DISULFID	By similarity.	might get lost (downstream of altered splice site)
623	623	DISULFID	By similarity.	might get lost (downstream of altered splice site)
628	686	DOMAIN	Sushi 11.	might get lost (downstream of altered splice site)
630	630	DISULFID	By similarity.	might get lost (downstream of altered splice site)
659	659	DISULFID	By similarity.	might get lost (downstream of altered splice site)
673	673	DISULFID	By similarity.	might get lost (downstream of altered splice site)
684	684	DISULFID	By similarity.	might get lost (downstream of altered splice site)
689	746	DOMAIN	Sushi 12.	might get lost (downstream of altered splice site)
691	691	DISULFID	By similarity.	might get lost (downstream of altered splice site)
700	703	STRAND		might get lost (downstream of altered splice site)
714	718	STRAND		might get lost (downstream of altered splice site)
718	718	CARBOHYD	N-linked (GlcNAc...) (Potential).	might get lost (downstream of altered splice site)
719	719	DISULFID	By similarity.	might get lost (downstream of altered splice site)
729	732	STRAND		might get lost (downstream of altered splice site)
733	733	DISULFID	By similarity.	might get lost (downstream of altered splice site)
744	744	DISULFID	By similarity.	might get lost (downstream of altered splice site)
751	805	DOMAIN	Sushi 13.	might get lost (downstream of altered splice site)
753	753	DISULFID	By similarity.	might get lost (downstream of altered splice site)
757	760	STRAND		might get lost (downstream of altered splice site)
765	767	HELIX		might get lost (downstream of altered splice site)
769	771	STRAND		might get lost (downstream of altered splice site)
781	781	DISULFID	By similarity.	might get lost (downstream of altered splice site)
790	792	STRAND		might get lost (downstream of altered splice site)
792	792	DISULFID	By similarity.	might get lost (downstream of altered splice site)
797	799	STRAND		might get lost (downstream of altered splice site)
802	802	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
803	803	DISULFID	By similarity.	might get lost (downstream of altered splice site)
809	866	DOMAIN	Sushi 14.	might get lost (downstream of altered splice site)
811	811	DISULFID	By similarity.	might get lost (downstream of altered splice site)
822	822	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
839	839	DISULFID	By similarity.	might get lost (downstream of altered splice site)
853	853	DISULFID	By similarity.	might get lost (downstream of altered splice site)
864	864	DISULFID	By similarity.	might get lost (downstream of altered splice site)
868	928	DOMAIN	Sushi 15.	might get lost (downstream of altered splice site)
870	870	DISULFID	By similarity.	might get lost (downstream of altered splice site)
870	872	STRAND		might get lost (downstream of altered splice site)
879	881	STRAND		might get lost (downstream of altered splice site)
882	882	CARBOHYD	N-linked (GlcNAc...) (complex).	might get lost (downstream of altered splice site)
883	887	STRAND		might get lost (downstream of altered splice site)
889	891	STRAND		might get lost (downstream of altered splice site)
895	904	STRAND		might get lost (downstream of altered splice site)
901	901	DISULFID	By similarity.	might get lost (downstream of altered splice site)
906	909	STRAND		might get lost (downstream of altered splice site)
911	911	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
911	916	STRAND		might get lost (downstream of altered splice site)
915	915	DISULFID	By similarity.	might get lost (downstream of altered splice site)
925	927	STRAND		might get lost (downstream of altered splice site)
926	926	DISULFID	By similarity.	might get lost (downstream of altered splice site)
929	986	DOMAIN	Sushi 16.	might get lost (downstream of altered splice site)
931	931	DISULFID	By similarity.	might get lost (downstream of altered splice site)
940	943	STRAND		might get lost (downstream of altered splice site)
950	952	STRAND		might get lost (downstream of altered splice site)
957	959	STRAND		might get lost (downstream of altered splice site)
959	959	DISULFID	By similarity.	might get lost (downstream of altered splice site)
965	967	STRAND		might get lost (downstream of altered splice site)
971	974	STRAND		might get lost (downstream of altered splice site)
973	973	DISULFID	By similarity.	might get lost (downstream of altered splice site)
977	979	STRAND		might get lost (downstream of altered splice site)
984	984	DISULFID	By similarity.	might get lost (downstream of altered splice site)
987	1045	DOMAIN	Sushi 17.	might get lost (downstream of altered splice site)
989	989	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1018	1018	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1029	1029	CARBOHYD	N-linked (GlcNAc...).	might get lost (downstream of altered splice site)
1032	1032	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1043	1043	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1046	1104	DOMAIN	Sushi 18.	might get lost (downstream of altered splice site)
1048	1048	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1057	1059	STRAND		might get lost (downstream of altered splice site)
1065	1067	STRAND		might get lost (downstream of altered splice site)
1072	1077	STRAND		might get lost (downstream of altered splice site)
1077	1077	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1082	1085	STRAND		might get lost (downstream of altered splice site)
1087	1092	STRAND		might get lost (downstream of altered splice site)
1091	1091	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1095	1095	CARBOHYD	N-linked (GlcNAc...) (Potential).	might get lost (downstream of altered splice site)
1101	1103	STRAND		might get lost (downstream of altered splice site)
1102	1102	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1107	1165	DOMAIN	Sushi 19.	might get lost (downstream of altered splice site)
1109	1109	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1118	1122	STRAND		might get lost (downstream of altered splice site)
1126	1128	STRAND		might get lost (downstream of altered splice site)
1133	1138	STRAND		might get lost (downstream of altered splice site)
1138	1138	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1143	1146	STRAND		might get lost (downstream of altered splice site)
1148	1153	STRAND		might get lost (downstream of altered splice site)
1152	1152	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1162	1164	STRAND		might get lost (downstream of altered splice site)
1163	1163	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1167	1167	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1167	1170	STRAND		might get lost (downstream of altered splice site)
1170	1230	DOMAIN	Sushi 20.	might get lost (downstream of altered splice site)
1171	1177	HELIX		might get lost (downstream of altered splice site)
1179	1181	STRAND		might get lost (downstream of altered splice site)
1182	1186	TURN		might get lost (downstream of altered splice site)
1189	1191	STRAND		might get lost (downstream of altered splice site)
1196	1201	STRAND		might get lost (downstream of altered splice site)
1201	1201	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1202	1204	TURN		might get lost (downstream of altered splice site)
1205	1207	STRAND		might get lost (downstream of altered splice site)
1214	1217	STRAND		might get lost (downstream of altered splice site)
1218	1218	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1228	1228	DISULFID	By similarity.	might get lost (downstream of altered splice site)
1228	1230	STRAND		might get lost (downstream of altered splice site)

length of protein

normal

AA sequence altered

yes

position of stopcodon in wt / mu CDS

1158 / 1158

position (AA) of stopcodon in wt / mu AA sequence

386 / 386

position of stopcodon in wt / mu cDNA

1220 / 1220

poly(A) signal

N/A

conservation
nucleotide level for all changes - no scoring up to now

N/A

position of start ATG in wt / mu cDNA

63 / 63

chromosome

strand

last intron/exon boundary

1207

theoretical NMD boundary in CDS

1094

length of CDS

1158

coding sequence (CDS) position

1099

cDNA position
(for ins/del: last normal base / first normal base)

1161

gDNA position
(for ins/del: last normal base / first normal base)

38317

chromosomal position
(for ins/del: last normal base / first normal base)

196659324

original gDNA sequence snippet

AAGCGCAGACCACAGTTACATGTATGGAGAATGGCTGGTCT

altered gDNA sequence snippet

AAGCGCAGACCACAGTTACAAGTATGGAGAATGGCTGGTCT

original cDNA sequence snippet

AAGCGCAGACCACAGTTACATGTATGGAGAATGGCTGGTCT

altered cDNA sequence snippet

AAGCGCAGACCACAGTTACAAGTATGGAGAATGGCTGGTCT

wildtype AA sequence

MRLLAKIICL MLWAICVAED CNELPPRRNT EILTGSWSDQ TYPEGTQAIY KCRPGYRSLG
NVIMVCRKGE WVALNPLRKC QKRPCGHPGD TPFGTFTLTG GNVFEYGVKA VYTCNEGYQL
LGEINYRECD TDGWTNDIPI CEEISCKSPD VINGSPISQK IIYKENERFQ YKCNMGYEYS
ERGDAVCTES GWRPLPSCEE KSCDNPYIPN GDYSPLRIKH RTGDEITYQC RNGFYPATRG
NTAKCTSTGW IPAPRCTLKP CDYPDIKHGG LYHENMRRPY FPVAVGKYYS YYCDEHFETP
SGSYWDHIHC TQDGWSPAVP CLRKCYFPYL ENGYNQNHGR KFVQGKSIDV ACHPGYALPK
AQTTVTCMEN GWSPTPRCIR VSFTL*

mutated AA sequence

speed

0.64 s

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project