mutation t@sting |
documentation |
Prediction |
disease causing |
Model: without_aae, prob: 1 (classification due to ClinVar, real probability is shown anyway) (explain) | ||||||||||||
Summary |
|
hyperlink | ||||||||||||
analysed issue | analysis result | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | |||||||||||||
alteration (phys. location) | chr11:61723221G>CN/A show variant in all transcripts IGV | |||||||||||||
HGNC symbol | BEST1 | |||||||||||||
Ensembl transcript ID | ENST00000534553 | |||||||||||||
Genbank transcript ID | N/A | |||||||||||||
UniProt peptide | N/A | |||||||||||||
alteration type | single base exchange | |||||||||||||
alteration region | 5'UTR | |||||||||||||
DNA changes | cDNA.537G>C g.5929G>C | |||||||||||||
AA changes | N/A | |||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | |||||||||||||
frameshift | N/A | |||||||||||||
known variant | Reference ID: rs28940273
Allele 'C' was neither found in ExAC nor 1000G. known disease mutation: rs2727 (pathogenic for Vitelliform macular dystrophy type 2|not provided) dbSNP NCBI variation viewer known disease mutation at this position, please check HGMD for details (HGMD ID CM982021) known disease mutation at this position, please check HGMD for details (HGMD ID CM982021) known disease mutation at this position, please check HGMD for details (HGMD ID CM982021) | |||||||||||||
regulatory features | DNase1, Open Chromatin, DNase1 Hypersensitive Site Gene Associated, Regulatory Feature, Gene associated regulatory feature H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation H3K4me2, Histone, Histone 3 Lysine 4 Di-Methylation PolII, Polymerase, RNA Polymerase II Promoter Associated, Regulatory Feature, Promoter like regulatory feature TAF1, Transcription Factor, TAF1 Transcription Factor Binding | |||||||||||||
phyloP / phastCons |
| |||||||||||||
splice sites | no abrogation of potential splice sites | |||||||||||||
distance from splice site | 32 | |||||||||||||
Kozak consensus sequence altered? | no | |||||||||||||
conservation protein level for non-synonymous changes | N/A | |||||||||||||
protein features | N/A | |||||||||||||
length of protein | N/A | |||||||||||||
AA sequence altered | N/A | |||||||||||||
position of stopcodon in wt / mu CDS | N/A | |||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | |||||||||||||
position of stopcodon in wt / mu cDNA | N/A | |||||||||||||
poly(A) signal | N/A | |||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | |||||||||||||
position of start ATG in wt / mu cDNA | 577 / 577 | |||||||||||||
chromosome | 11 | |||||||||||||
strand | 1 | |||||||||||||
last intron/exon boundary | 740 | |||||||||||||
theoretical NMD boundary in CDS | 113 | |||||||||||||
length of CDS | 168 | |||||||||||||
coding sequence (CDS) position | N/A | |||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | 537 | |||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 5929 | |||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 61723221 | |||||||||||||
original gDNA sequence snippet | ACGCTGGTCGTGACCCGCTGGTGGAACCAGTACGAGAACCT | |||||||||||||
altered gDNA sequence snippet | ACGCTGGTCGTGACCCGCTGCTGGAACCAGTACGAGAACCT | |||||||||||||
original cDNA sequence snippet | ACGCTGGTCGTGACCCGCTGGTGGAACCAGTACGAGAACCT | |||||||||||||
altered cDNA sequence snippet | ACGCTGGTCGTGACCCGCTGCTGGAACCAGTACGAGAACCT | |||||||||||||
wildtype AA sequence | MSLVSGFVEG KDEQGRLLRR TLIRYANLGN VLILRSVSTA VYKRFPSAQH LVQAA* | |||||||||||||
mutated AA sequence | N/A | |||||||||||||
speed | 1.66 s | |||||||||||||