mutation t@sting

Prediction

polymorphism

Model: without_aae, prob: 2.15675960596166e-08 (classification due to TGP/ExAC, real probability is shown anyway) (explain)

Summary

homozygous in TGP or ExAC
protein features (might be) affected
splice site changes

hyperlink

analysed issue

analysis result

name of alteration

no title

alteration (phys. location)

chr17:44067382T>CN/A show variant in all transcripts IGV

HGNC symbol

MAPT

Ensembl transcript ID

ENST00000431008

Genbank transcript ID

N/A

UniProt peptide

P10636

alteration type

single base exchange

alteration region

intron

DNA changes

g.95635T>C

AA changes

N/A

position(s) of altered AA
if AA alteration in CDS

N/A

frameshift

N/A

known variant

Reference ID: rs2258689

database	homozygous (C/C)	heterozygous	allele carriers
1000G	334	899	1233
ExAC	5535	21697	27232

regulatory features

H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation

phyloP / phastCons

	PhyloP	PhastCons
(flanking)	1.217	1
	0.432	1
(flanking)	1.211	1

explain score(s) and/or inspect your position(s) in in UCSC Genome Browser

splice sites

effect	gDNA position	score	wt detection sequence	exon-intron border
Acc marginally increased	95632	wt: 0.7408 / mu: 0.7645 (marginal change - not scored)	wt: CAGAGCCACCTTCCTCTCCTAAATACGTCTCTTCTGTCACT mu: CAGAGCCACCTTCCTCTCCTAAACACGTCTCTTCTGTCACT	ccta\|AATA
Acc marginally increased	95635	wt: 0.3764 / mu: 0.4124 (marginal change - not scored)	wt: AGCCACCTTCCTCTCCTAAATACGTCTCTTCTGTCACTTCC mu: AGCCACCTTCCTCTCCTAAACACGTCTCTTCTGTCACTTCC	aaat\|ACGT
Acc increased	95630	wt: 0.26 / mu: 0.41	wt: CCCAGAGCCACCTTCCTCTCCTAAATACGTCTCTTCTGTCA mu: CCCAGAGCCACCTTCCTCTCCTAAACACGTCTCTTCTGTCA	ctcc\|TAAA
Donor marginally increased	95632	wt: 0.9552 / mu: 0.9678 (marginal change - not scored)	wt: CTCCTAAATACGTCT mu: CTCCTAAACACGTCT	CCTA\|aata

distance from splice site

1444

Kozak consensus sequence altered?

N/A

conservation
protein level for non-synonymous changes

N/A

protein features

start (aa)	end (aa)	feature	details
214	214	MOD_RES	Phosphoserine; by SGK1.	might get lost (downstream of altered splice site)
381	381	SITE	Not glycated.	might get lost (downstream of altered splice site)
383	383	CARBOHYD	N-linked (Glc) (glycation); in PHF-tau; in vitro.	might get lost (downstream of altered splice site)
391	391	SITE	Not glycated.	might get lost (downstream of altered splice site)
392	392	SITE	Not glycated.	might get lost (downstream of altered splice site)
394	394	SITE	Not glycated.	might get lost (downstream of altered splice site)
414	414	CONFLICT	H -> L (in Ref. 5; AAC04277).	might get lost (downstream of altered splice site)
465	465	SITE	Not glycated.	might get lost (downstream of altered splice site)
467	467	CARBOHYD	N-linked (Glc) (glycation); in PHF-tau; in vitro.	might get lost (downstream of altered splice site)
470	470	MOD_RES	Phosphothreonine; by PDPK1.	might get lost (downstream of altered splice site)
480	480	CARBOHYD	N-linked (Glc) (glycation); in PHF-tau; in vitro.	might get lost (downstream of altered splice site)
484	484	MOD_RES	Deamidated asparagine; in tau and PHF- tau; partial.	might get lost (downstream of altered splice site)
491	491	CARBOHYD	N-linked (Glc) (glycation); in PHF-tau; in vitro.	might get lost (downstream of altered splice site)
492	492	MOD_RES	Phosphothreonine; by PDPK1.	might get lost (downstream of altered splice site)
497	497	SITE	Not glycated.	might get lost (downstream of altered splice site)
498	498	MOD_RES	Phosphothreonine; by PDPK1.	might get lost (downstream of altered splice site)
507	507	SITE	Not glycated.	might get lost (downstream of altered splice site)
514	514	MOD_RES	Phosphotyrosine; by TTBK1.	might get lost (downstream of altered splice site)
515	515	MOD_RES	Phosphoserine; by PDPK1 and TTBK1.	might get lost (downstream of altered splice site)
515	515	MUTAGEN	S->E: No association with plasma membrane.	might get lost (downstream of altered splice site)
516	516	MOD_RES	Phosphoserine; by PDPK1 and TTBK1.	might get lost (downstream of altered splice site)
516	516	MUTAGEN	S->E: No association with plasma membrane.	might get lost (downstream of altered splice site)
519	519	MOD_RES	Phosphoserine; by CK1, PDPK1 and TTBK1.	might get lost (downstream of altered splice site)
519	519	MUTAGEN	S->E: No association with plasma membrane.	might get lost (downstream of altered splice site)
522	522	MOD_RES	Phosphothreonine; by CK1 and PDPK1.	might get lost (downstream of altered splice site)
525	525	CARBOHYD	O-linked (GlcNAc...).	might get lost (downstream of altered splice site)
529	529	MOD_RES	Phosphothreonine; by PDPK1.	might get lost (downstream of altered splice site)
531	531	MOD_RES	Phosphoserine; by PKA.	might get lost (downstream of altered splice site)
531	531	MUTAGEN	S->A: No decrease in microtubule-binding and nucleation activity after in vitro phosphorylation of mutant protein.	might get lost (downstream of altered splice site)
534	534	MOD_RES	Phosphothreonine; by PDPK1.	might get lost (downstream of altered splice site)
541	541	SITE	Not glycated.	might get lost (downstream of altered splice site)
542	542	CARBOHYD	N-linked (Glc) (glycation); in PHF-tau; in vitro.	might get lost (downstream of altered splice site)
548	548	MUTAGEN	T->E: No association with plasma membrane.	might get lost (downstream of altered splice site)
548	548	MUTAGEN	T->A: 50% Decrease in microtubule-binding after in vitro phosphorylation of mutant protein.	might get lost (downstream of altered splice site)
548	548	MOD_RES	Phosphothreonine; by GSK3-beta and PDPK1.	might get lost (downstream of altered splice site)
551	551	CARBOHYD	N-linked (Glc) (glycation); in PHF-tau; in vitro.	might get lost (downstream of altered splice site)
552	552	MUTAGEN	S->A: 70% decrease in microtubule-binding after in vitro phosphorylation of mutant protein.	might get lost (downstream of altered splice site)
552	552	MOD_RES	Phosphoserine; by PDPK1.	might get lost (downstream of altered splice site)
552	552	MUTAGEN	S->E: No association with plasma membrane.	might get lost (downstream of altered splice site)
554	554	MOD_RES	Phosphoserine; by PHK.	might get lost (downstream of altered splice site)
555	555	CARBOHYD	O-linked (GlcNAc...).	might get lost (downstream of altered splice site)
557	557	SITE	Not glycated.	might get lost (downstream of altered splice site)
557	557	CONFLICT	K -> M (in Ref. 12; AAS17881).	might get lost (downstream of altered splice site)
561	591	REPEAT	Tau/MAP 1.	might get lost (downstream of altered splice site)
571	571	SITE	Not glycated.	might get lost (downstream of altered splice site)
571	571	CROSSLNK	Glycyl lysine isopeptide (Lys-Gly) (interchain with G-Cter in ubiquitin); in PHF-tau.	might get lost (downstream of altered splice site)
574	574	SITE	Not glycated.	might get lost (downstream of altered splice site)
576	576	CARBOHYD	N-linked (Glc) (glycation); in PHF-tau; in vitro.	might get lost (downstream of altered splice site)
579	579	MUTAGEN	S->A: 8% decrease in microtubule-binding after in vitro phosphorylation of mutant protein.	might get lost (downstream of altered splice site)
579	579	MOD_RES	Phosphoserine; by MARK1, BRSK1, BRSK2 and PHK.	might get lost (downstream of altered splice site)
584	584	SITE	Not glycated.	might get lost (downstream of altered splice site)
591	591	CONFLICT	K -> S (in Ref. 12; AAS17881).	might get lost (downstream of altered splice site)
591	591	SITE	Not glycated.	might get lost (downstream of altered splice site)
592	622	REPEAT	Tau/MAP 2.	might get lost (downstream of altered splice site)
596	596	MOD_RES	Deamidated asparagine; in tau and PHF- tau; partial.	might get lost (downstream of altered splice site)
597	597	CARBOHYD	N-linked (Glc) (glycation); in PHF-tau; in vitro.	might get lost (downstream of altered splice site)
598	598	CARBOHYD	N-linked (Glc) (glycation); in PHF-tau; in vitro.	might get lost (downstream of altered splice site)
602	602	MOD_RES	Phosphoserine; by PHK.	might get lost (downstream of altered splice site)
606	606	MOD_RES	Phosphoserine; by PHK.	might get lost (downstream of altered splice site)
607	607	SITE	Not glycated.	might get lost (downstream of altered splice site)
608	608	DISULFID	By similarity.	might get lost (downstream of altered splice site)
610	610	MOD_RES	Phosphoserine; by MARK1; in PHF-tau.	might get lost (downstream of altered splice site)
611	611	SITE	Not glycated.	might get lost (downstream of altered splice site)
615	615	SITE	Not glycated.	might get lost (downstream of altered splice site)
617	617	CONFLICT	V -> Q (in Ref. 16; AA sequence).	might get lost (downstream of altered splice site)
622	622	CONFLICT	S -> K (in Ref. 16; AA sequence).	might get lost (downstream of altered splice site)
622	622	MOD_RES	Phosphoserine; by MARK1; in PHF-tau.	might get lost (downstream of altered splice site)
623	653	REPEAT	Tau/MAP 3.	might get lost (downstream of altered splice site)
628	628	CROSSLNK	Glycyl lysine isopeptide (Lys-Gly) (interchain with G-Cter in ubiquitin); in PHF-tau.	might get lost (downstream of altered splice site)
628	628	SITE	Not glycated.	might get lost (downstream of altered splice site)
634	634	SITE	Not glycated.	might get lost (downstream of altered splice site)
638	638	SITE	Not glycated.	might get lost (downstream of altered splice site)
639	639	DISULFID	By similarity.	might get lost (downstream of altered splice site)
641	641	MOD_RES	Phosphoserine; by MARK1; in PHF-tau.	might get lost (downstream of altered splice site)
648	648	SITE	Not glycated.	might get lost (downstream of altered splice site)
654	685	REPEAT	Tau/MAP 4.	might get lost (downstream of altered splice site)
657	657	SITE	Not glycated.	might get lost (downstream of altered splice site)
660	660	SITE	Not glycated.	might get lost (downstream of altered splice site)
664	664	CARBOHYD	N-linked (Glc) (glycation); in PHF-tau; in vitro.	might get lost (downstream of altered splice site)
669	669	MOD_RES	Phosphoserine; by PHK.	might get lost (downstream of altered splice site)
670	670	CROSSLNK	Glycyl lysine isopeptide (Lys-Gly) (interchain with G-Cter in ubiquitin); in PHF-tau.	might get lost (downstream of altered splice site)
670	670	CARBOHYD	N-linked (Glc) (glycation); in PHF-tau; in vitro.	might get lost (downstream of altered splice site)
673	673	MOD_RES	Phosphoserine; by MARK1; in PHF-tau.	might get lost (downstream of altered splice site)
686	686	CARBOHYD	N-linked (Glc) (glycation); in PHF-tau; in vitro.	might get lost (downstream of altered splice site)
687	687	SITE	Not glycated.	might get lost (downstream of altered splice site)
692	692	SITE	Not glycated.	might get lost (downstream of altered splice site)
700	700	SITE	Not glycated.	might get lost (downstream of altered splice site)
702	702	SITE	Not glycated.	might get lost (downstream of altered splice site)
712	712	SITE	Not glycated.	might get lost (downstream of altered splice site)
713	713	MUTAGEN	S->E: No association with plasma membrane.	might get lost (downstream of altered splice site)
713	713	MOD_RES	Phosphoserine; by CK1 and PDPK1.	might get lost (downstream of altered splice site)
717	717	CARBOHYD	O-linked (GlcNAc...).	might get lost (downstream of altered splice site)
717	717	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
720	720	MOD_RES	Phosphothreonine.	might get lost (downstream of altered splice site)
721	721	MUTAGEN	S->E: No association with plasma membrane.	might get lost (downstream of altered splice site)
721	721	MOD_RES	Phosphoserine; by CK1 and PDPK1.	might get lost (downstream of altered splice site)
726	726	MOD_RES	Phosphoserine.	might get lost (downstream of altered splice site)
726	726	MUTAGEN	S->E: No association with plasma membrane.	might get lost (downstream of altered splice site)
729	729	MOD_RES	Phosphoserine (By similarity).	might get lost (downstream of altered splice site)
730	730	MUTAGEN	S->E: No association with plasma membrane.	might get lost (downstream of altered splice site)
731	731	MOD_RES	Phosphothreonine (By similarity).	might get lost (downstream of altered splice site)
733	733	MOD_RES	Phosphoserine; by CaMK2 and TTBK1.	might get lost (downstream of altered splice site)
739	739	MOD_RES	Phosphoserine; by PDPK1 and TTBK1.	might get lost (downstream of altered splice site)
739	739	MUTAGEN	S->E: No association with plasma membrane.	might get lost (downstream of altered splice site)
744	744	MOD_RES	Phosphothreonine; by TTBK1.	might get lost (downstream of altered splice site)
755	755	SITE	Not glycated.	might get lost (downstream of altered splice site)

length of protein

N/A

AA sequence altered

N/A

position of stopcodon in wt / mu CDS

N/A

position (AA) of stopcodon in wt / mu AA sequence

N/A

position of stopcodon in wt / mu cDNA

N/A

poly(A) signal

N/A

conservation
nucleotide level for all changes - no scoring up to now

N/A

position of start ATG in wt / mu cDNA

1 / 1

chromosome

strand

last intron/exon boundary

1018

theoretical NMD boundary in CDS

967

length of CDS

1233

coding sequence (CDS) position

N/A

cDNA position
(for ins/del: last normal base / first normal base)

N/A

gDNA position
(for ins/del: last normal base / first normal base)

95635

chromosomal position
(for ins/del: last normal base / first normal base)

44067382

original gDNA sequence snippet

AGCCACCTTCCTCTCCTAAATACGTCTCTTCTGTCACTTCC

altered gDNA sequence snippet

AGCCACCTTCCTCTCCTAAACACGTCTCTTCTGTCACTTCC

original cDNA sequence snippet

N/A

altered cDNA sequence snippet

N/A

wildtype AA sequence

MAEPRQEFEV MEDHAGTYGL GDRKDQGGYT MHQDQEGDTD AGLKESPLQT PTEDGSEEPG
SETSDAKSTP TAEDVTAPLV DEGAPGKQAA AQPHTEIPEG TTAEEAGIGD TPSLEDEAAG
HVTQARMVSK SKDGTGSDDK KAKGADGKTK IATPRGAAPP GQKGQANATR IPAKTPPAPK
TPPSSGEPPK SGDRSGYSSP GSPGTPGSRS RTPSLPTPPT REPKKVAVVR TPPKSPSSAK
SRLQTAPVPM PDLKNVKSKI GSTENLKHQP GGGKVQIVYK PVDLSKVTSK CGSLGNIHHK
PGGGQVEVKS EKLDFKDRVQ SKIGSLDNIT HVPGGGNKKI ETHKLTFREN AKAKTDHGAE
IVYKSPVVSG DTSPRHLSNV SSTGSIDMVD SPQLATLADE VSASLAKQGL *

mutated AA sequence

N/A

speed

0.97 s

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project