mutation t@sting |
documentation |
Prediction |
disease causing |
Model: without_aae, prob: 1 (classification due to ClinVar, real probability is shown anyway) (explain) | ||||||||||||
Summary |
|
hyperlink | ||||||||||||
analysed issue | analysis result | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | |||||||||||||
alteration (phys. location) | chr11:61725631C>TN/A show variant in all transcripts IGV | |||||||||||||
HGNC symbol | BEST1 | |||||||||||||
Ensembl transcript ID | ENST00000534553 | |||||||||||||
Genbank transcript ID | N/A | |||||||||||||
UniProt peptide | N/A | |||||||||||||
alteration type | single base exchange | |||||||||||||
alteration region | intron | |||||||||||||
DNA changes | g.8339C>T | |||||||||||||
AA changes | N/A | |||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | |||||||||||||
frameshift | N/A | |||||||||||||
known variant | Reference ID: rs28940570
known disease mutation: rs2737 (pathogenic for Retinal dystrophy|Vitelliform macular dystrophy type 2|not provided) dbSNP NCBI variation viewer known disease mutation at this position, please check HGMD for details (HGMD ID CM000841) known disease mutation at this position, please check HGMD for details (HGMD ID CM000841) known disease mutation at this position, please check HGMD for details (HGMD ID CM1414063) known disease mutation at this position, please check HGMD for details (HGMD ID CM000841) known disease mutation at this position, please check HGMD for details (HGMD ID CM1414063) known disease mutation at this position, please check HGMD for details (HGMD ID CM000841) | |||||||||||||
regulatory features | H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation | |||||||||||||
phyloP / phastCons |
| |||||||||||||
splice sites |
| |||||||||||||
distance from splice site | 2208 | |||||||||||||
Kozak consensus sequence altered? | N/A | |||||||||||||
conservation protein level for non-synonymous changes | N/A | |||||||||||||
protein features | N/A | |||||||||||||
length of protein | N/A | |||||||||||||
AA sequence altered | N/A | |||||||||||||
position of stopcodon in wt / mu CDS | N/A | |||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | |||||||||||||
position of stopcodon in wt / mu cDNA | N/A | |||||||||||||
poly(A) signal | N/A | |||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | |||||||||||||
position of start ATG in wt / mu cDNA | 577 / 577 | |||||||||||||
chromosome | 11 | |||||||||||||
strand | 1 | |||||||||||||
last intron/exon boundary | 740 | |||||||||||||
theoretical NMD boundary in CDS | 113 | |||||||||||||
length of CDS | 168 | |||||||||||||
coding sequence (CDS) position | N/A | |||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | N/A | |||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 8339 | |||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 61725631 | |||||||||||||
original gDNA sequence snippet | CTCCCAGGTGGTGACTGTGGCGGTGTACAGCTTCTTCCTGA | |||||||||||||
altered gDNA sequence snippet | CTCCCAGGTGGTGACTGTGGTGGTGTACAGCTTCTTCCTGA | |||||||||||||
original cDNA sequence snippet | N/A | |||||||||||||
altered cDNA sequence snippet | N/A | |||||||||||||
wildtype AA sequence | MSLVSGFVEG KDEQGRLLRR TLIRYANLGN VLILRSVSTA VYKRFPSAQH LVQAA* | |||||||||||||
mutated AA sequence | N/A | |||||||||||||
speed | 0.57 s | |||||||||||||