mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 0.292788242485705 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | |||||||||||||||
Summary |
|
hyperlink | |||||||||||||||
analysed issue | analysis result | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | ||||||||||||||||
alteration (phys. location) | chr10:21414892C>GN/A show variant in all transcripts IGV | ||||||||||||||||
HGNC symbol | C10orf113 | ||||||||||||||||
Ensembl transcript ID | ENST00000529198 | ||||||||||||||||
Genbank transcript ID | NM_001177483 | ||||||||||||||||
UniProt peptide | N/A | ||||||||||||||||
alteration type | single base exchange | ||||||||||||||||
alteration region | 3'UTR | ||||||||||||||||
DNA changes | cDNA.414G>C g.20597G>C | ||||||||||||||||
AA changes | N/A | ||||||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | ||||||||||||||||
frameshift | N/A | ||||||||||||||||
known variant | Reference ID: rs625223
| ||||||||||||||||
regulatory features | H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation | ||||||||||||||||
phyloP / phastCons |
| ||||||||||||||||
splice sites | splice site change occurs after stopcodon (at aa 120) splice site change occurs after stopcodon (at aa 122)
| ||||||||||||||||
distance from splice site | 196 | ||||||||||||||||
Kozak consensus sequence altered? | N/A | ||||||||||||||||
conservation protein level for non-synonymous changes | N/A | ||||||||||||||||
protein features | N/A | ||||||||||||||||
length of protein | N/A | ||||||||||||||||
AA sequence altered | N/A | ||||||||||||||||
position of stopcodon in wt / mu CDS | N/A | ||||||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | ||||||||||||||||
position of stopcodon in wt / mu cDNA | N/A | ||||||||||||||||
poly(A) signal | signal is predicted to be ok | ||||||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | ||||||||||||||||
position of start ATG in wt / mu cDNA | 52 / 52 | ||||||||||||||||
chromosome | 10 | ||||||||||||||||
strand | -1 | ||||||||||||||||
last intron/exon boundary | 219 | ||||||||||||||||
theoretical NMD boundary in CDS | 117 | ||||||||||||||||
length of CDS | 240 | ||||||||||||||||
coding sequence (CDS) position | N/A | ||||||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | 414 | ||||||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 20597 | ||||||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 21414892 | ||||||||||||||||
original gDNA sequence snippet | TCCAGGCAGCTCCTGAACCAGATCCAGGCAACTGGGCCAAG | ||||||||||||||||
altered gDNA sequence snippet | TCCAGGCAGCTCCTGAACCACATCCAGGCAACTGGGCCAAG | ||||||||||||||||
original cDNA sequence snippet | TCCAGGCAGCTCCTGAACCAGATCCAGGCAACTGGGCCAAG | ||||||||||||||||
altered cDNA sequence snippet | TCCAGGCAGCTCCTGAACCACATCCAGGCAACTGGGCCAAG | ||||||||||||||||
wildtype AA sequence | MAKSERRIYS MESMAPEISE DIGCPLAYMR ESVCALLINQ SFFSCVAEMY IPDMNRLEER TAALYPIGLV RQNGEPRRA* | ||||||||||||||||
mutated AA sequence | N/A | ||||||||||||||||
speed | 1.10 s | ||||||||||||||||