mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 0.872673479143236 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | |||||||||||||||
Summary |
|
hyperlink | |||||||||||||||
analysed issue | analysis result | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | ||||||||||||||||
alteration (phys. location) | chr3:187446211C>TN/A show variant in all transcripts IGV | ||||||||||||||||
HGNC symbol | LOC100131635 | ||||||||||||||||
Ensembl transcript ID | ENST00000437407 | ||||||||||||||||
Genbank transcript ID | N/A | ||||||||||||||||
UniProt peptide | N/A | ||||||||||||||||
alteration type | single base exchange | ||||||||||||||||
alteration region | intron | ||||||||||||||||
DNA changes | g.26111C>T | ||||||||||||||||
AA changes | N/A | ||||||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | ||||||||||||||||
frameshift | N/A | ||||||||||||||||
known variant | Reference ID: rs2229362
| ||||||||||||||||
regulatory features | H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation | ||||||||||||||||
phyloP / phastCons |
| ||||||||||||||||
splice sites |
| ||||||||||||||||
distance from splice site | 3948 | ||||||||||||||||
Kozak consensus sequence altered? | N/A | ||||||||||||||||
conservation protein level for non-synonymous changes | N/A | ||||||||||||||||
protein features | N/A | ||||||||||||||||
length of protein | N/A | ||||||||||||||||
AA sequence altered | N/A | ||||||||||||||||
position of stopcodon in wt / mu CDS | N/A | ||||||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | ||||||||||||||||
position of stopcodon in wt / mu cDNA | N/A | ||||||||||||||||
poly(A) signal | N/A | ||||||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | ||||||||||||||||
position of start ATG in wt / mu cDNA | 165 / 165 | ||||||||||||||||
chromosome | 3 | ||||||||||||||||
strand | 1 | ||||||||||||||||
last intron/exon boundary | 294 | ||||||||||||||||
theoretical NMD boundary in CDS | 79 | ||||||||||||||||
length of CDS | 153 | ||||||||||||||||
coding sequence (CDS) position | N/A | ||||||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | N/A | ||||||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 26111 | ||||||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 187446211 | ||||||||||||||||
original gDNA sequence snippet | CTCAGGGAACGTGGGGCCAGCGGTGTGGAGGCACATCTCTG | ||||||||||||||||
altered gDNA sequence snippet | CTCAGGGAACGTGGGGCCAGTGGTGTGGAGGCACATCTCTG | ||||||||||||||||
original cDNA sequence snippet | N/A | ||||||||||||||||
altered cDNA sequence snippet | N/A | ||||||||||||||||
wildtype AA sequence | MCYELDSIRI LTTGSKSESS GEQEAECLKS SYGTELLDET ISGNLAMNDK * | ||||||||||||||||
mutated AA sequence | N/A | ||||||||||||||||
speed | 0.92 s | ||||||||||||||||