Prediction |
polymorphism |
Model: without_aae, prob: 0.999999730797239 (classification due to TGP/ExAC,
real probability is shown anyway)
(explain) |
Summary |
- homozygous in TGP or ExAC
- protein features (might be) affected
- splice site changes
|
hyperlink |
analysed issue |
analysis result |
name of alteration | no title |
alteration (phys. location) | chr3:50334231T>AN/A
show variant in all transcripts IGV
|
HGNC symbol | HYAL3 |
Ensembl transcript ID | ENST00000513170 |
Genbank transcript ID | NM_001200032 |
UniProt peptide | O43820 |
alteration type | single base exchange |
alteration region | intron |
DNA changes | g.2669A>T |
AA changes | N/A |
position(s) of altered AA if AA alteration in CDS | N/A |
frameshift | N/A |
known variant | Reference ID: rs2269432
database | homozygous (A/A) | heterozygous | allele carriers |
1000G | 256 | 578 | 834 |
ExAC | 2950 | 6792 | 9742 |
|
regulatory features | H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation |
phyloP / phastCons | | PhyloP | PhastCons |
(flanking) | -0.403 | 0 | | -0.154 | 0.001 | (flanking) | 0.952 | 0.028 | explain score(s) and/or inspect your position(s) in in UCSC Genome Browser |
splice sites | effect | gDNA position | score | wt detection sequence | exon-intron border | Acc marginally increased | 2660 | wt: 0.8908 / mu: 0.9041 (marginal change - not scored) | wt: TCCCCACAGCCCCCTCTCCCCGGCCACCCAGGAAGGCCCCA mu: TCCCCACAGCCCCCTCTCCCCGGCCACCCTGGAAGGCCCCA | cccc|GGCC | Acc marginally increased | 2661 | wt: 0.9392 / mu: 0.9465 (marginal change - not scored) | wt: CCCCACAGCCCCCTCTCCCCGGCCACCCAGGAAGGCCCCAA mu: CCCCACAGCCCCCTCTCCCCGGCCACCCTGGAAGGCCCCAA | cccg|GCCA | Acc marginally increased | 2662 | wt: 0.6046 / mu: 0.6610 (marginal change - not scored) | wt: CCCACAGCCCCCTCTCCCCGGCCACCCAGGAAGGCCCCAAA mu: CCCACAGCCCCCTCTCCCCGGCCACCCTGGAAGGCCCCAAA | ccgg|CCAC | Acc gained | 2671 | 0.69 | mu: CCCTCTCCCCGGCCACCCTGGAAGGCCCCAAACCTGACTGC | ctgg|AAGG |
|
distance from splice site | 1947 |
Kozak consensus sequence altered? | N/A |
conservation protein level for non-synonymous changes | N/A |
protein features | start (aa) | end (aa) | feature | details | | 1 | 20 | SIGNAL | Potential. | might get lost (downstream of altered splice site) | 42 | 42 | DISULFID | By similarity. | might get lost (downstream of altered splice site) | 54 | 54 | CONFLICT | A -> S (in Ref. 5; AAH05896). | might get lost (downstream of altered splice site) | 69 | 69 | CARBOHYD | N-linked (GlcNAc...) (Potential). | might get lost (downstream of altered splice site) | 129 | 129 | ACT_SITE | Proton donor (By similarity). | might get lost (downstream of altered splice site) | 205 | 205 | DISULFID | By similarity. | might get lost (downstream of altered splice site) | 215 | 215 | CARBOHYD | N-linked (GlcNAc...) (Potential). | might get lost (downstream of altered splice site) | 220 | 220 | DISULFID | By similarity. | might get lost (downstream of altered splice site) | 331 | 331 | DISULFID | By similarity. | might get lost (downstream of altered splice site) | 352 | 407 | DOMAIN | EGF-like. | might get lost (downstream of altered splice site) | 356 | 356 | DISULFID | By similarity. | might get lost (downstream of altered splice site) | 361 | 361 | DISULFID | By similarity. | might get lost (downstream of altered splice site) | 367 | 367 | DISULFID | By similarity. | might get lost (downstream of altered splice site) | 395 | 395 | DISULFID | By similarity. | might get lost (downstream of altered splice site) | 397 | 397 | DISULFID | By similarity. | might get lost (downstream of altered splice site) | 406 | 406 | DISULFID | By similarity. | might get lost (downstream of altered splice site) |
|
length of protein | N/A |
AA sequence altered | N/A |
position of stopcodon in wt / mu CDS | N/A |
position (AA) of stopcodon in wt / mu AA sequence | N/A |
position of stopcodon in wt / mu cDNA | N/A |
poly(A) signal | N/A |
conservation nucleotide level for all changes - no scoring up to now | N/A |
position of start ATG in wt / mu cDNA | 19 / 19 |
chromosome | 3 |
strand | -1 |
last intron/exon boundary | 166 |
theoretical NMD boundary in CDS | 97 |
length of CDS | 417 |
coding sequence (CDS) position | N/A |
cDNA position (for ins/del: last normal base / first normal base) | N/A |
gDNA position (for ins/del: last normal base / first normal base) | 2669 |
chromosomal position (for ins/del: last normal base / first normal base) | 50334231 |
original gDNA sequence snippet | CCCCCTCTCCCCGGCCACCCAGGAAGGCCCCAAACCTGACT |
altered gDNA sequence snippet | CCCCCTCTCCCCGGCCACCCTGGAAGGCCCCAAACCTGACT |
original cDNA sequence snippet | N/A |
altered cDNA sequence snippet | N/A |
wildtype AA sequence | MLPPAHHQAF VRHRLEEAFR VALVGHRHPL PVLAYVRLTH RRSGRFLSQE ECWHLHDYLV DTLGPYVINV TRAAMACSHQ RCHGHGRCAR RDPGQMEAFL HLWPDGSLGD WKSFSCHCYW GWAGPTCQEP RPGPKEAV* |
mutated AA sequence | N/A |
speed | 0.15 s |
|
|