Prediction |
polymorphism |
Model: without_aae, prob: 0.00684955316770625 (classification due to TGP/ExAC,
real probability is shown anyway)
(explain) |
Summary |
- homozygous in TGP or ExAC
- protein features (might be) affected
- splice site changes
|
hyperlink |
analysed issue |
analysis result |
name of alteration | no title |
alteration (phys. location) | chr11:62951221C>GN/A
show variant in all transcripts IGV
|
HGNC symbol | SLC22A10 |
Ensembl transcript ID | ENST00000535888 |
Genbank transcript ID | N/A |
UniProt peptide | Q63ZE4 |
alteration type | single base exchange |
alteration region | intron |
DNA changes | g.45883C>G |
AA changes | N/A |
position(s) of altered AA if AA alteration in CDS | N/A |
frameshift | N/A |
known variant | Reference ID: rs11231397
database | homozygous (G/G) | heterozygous | allele carriers |
1000G | 459 | 1187 | 1646 |
ExAC | 10521 | 11725 | 22246 |
|
regulatory features | H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation |
phyloP / phastCons | | PhyloP | PhastCons |
(flanking) | 0.435 | 0.763 | | -0.783 | 0.693 | (flanking) | 1.495 | 0.716 | explain score(s) and/or inspect your position(s) in in UCSC Genome Browser |
splice sites | splice site change before start ATG (at aa -135) | effect | gDNA position | score | detection sequence | exon-intron border | Acc marginally increased | 45873 | wt: 0.9139 / mu: 0.9214 (marginal change - not scored) | wt: TTCTTCATTCCATTCCTGTGTGCAGCTTTTCTAAGTTCCTT mu: TTCTTCATTCCATTCCTGTGTGCAGCTTTTGTAAGTTCCTT | gtgt|GCAG | Acc gained | 45882 | 0.64 | mu: CCATTCCTGTGTGCAGCTTTTGTAAGTTCCTTTAAGCCCTC | tttt|GTAA |
|
distance from splice site | 16805 |
Kozak consensus sequence altered? | N/A |
conservation protein level for non-synonymous changes | N/A |
protein features | start (aa) | end (aa) | feature | details | | 1 | 15 | TOPO_DOM | Cytoplasmic (Potential). | might get lost (downstream of altered splice site) | 16 | 36 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 37 | 145 | TOPO_DOM | Extracellular (Potential). | might get lost (downstream of altered splice site) | 56 | 56 | CARBOHYD | N-linked (GlcNAc...) (Potential). | might get lost (downstream of altered splice site) | 102 | 102 | CARBOHYD | N-linked (GlcNAc...) (Potential). | might get lost (downstream of altered splice site) | 146 | 166 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 167 | 193 | TOPO_DOM | Cytoplasmic (Potential). | might get lost (downstream of altered splice site) | 194 | 214 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 215 | 230 | TOPO_DOM | Extracellular (Potential). | might get lost (downstream of altered splice site) | 231 | 251 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 252 | 259 | TOPO_DOM | Cytoplasmic (Potential). | might get lost (downstream of altered splice site) | 260 | 280 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 281 | 349 | TOPO_DOM | Extracellular (Potential). | might get lost (downstream of altered splice site) | 350 | 370 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 371 | 377 | TOPO_DOM | Cytoplasmic (Potential). | might get lost (downstream of altered splice site) | 378 | 398 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 399 | 406 | TOPO_DOM | Extracellular (Potential). | might get lost (downstream of altered splice site) | 407 | 427 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 428 | 436 | TOPO_DOM | Cytoplasmic (Potential). | might get lost (downstream of altered splice site) | 437 | 457 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 458 | 472 | TOPO_DOM | Extracellular (Potential). | might get lost (downstream of altered splice site) | 473 | 493 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 494 | 495 | TOPO_DOM | Cytoplasmic (Potential). | might get lost (downstream of altered splice site) | 496 | 516 | TRANSMEM | Helical; (Potential). | might get lost (downstream of altered splice site) | 517 | 541 | TOPO_DOM | Extracellular (Potential). | might get lost (downstream of altered splice site) |
|
length of protein | N/A |
AA sequence altered | N/A |
position of stopcodon in wt / mu CDS | N/A |
position (AA) of stopcodon in wt / mu AA sequence | N/A |
position of stopcodon in wt / mu cDNA | N/A |
poly(A) signal | N/A |
conservation nucleotide level for all changes - no scoring up to now | N/A |
position of start ATG in wt / mu cDNA | 541 / 541 |
chromosome | 11 |
strand | 1 |
last intron/exon boundary | 1105 |
theoretical NMD boundary in CDS | 514 |
length of CDS | 444 |
coding sequence (CDS) position | N/A |
cDNA position (for ins/del: last normal base / first normal base) | N/A |
gDNA position (for ins/del: last normal base / first normal base) | 45883 |
chromosomal position (for ins/del: last normal base / first normal base) | 62951221 |
original gDNA sequence snippet | CATTCCTGTGTGCAGCTTTTCTAAGTTCCTTTAAGCCCTCT |
altered gDNA sequence snippet | CATTCCTGTGTGCAGCTTTTGTAAGTTCCTTTAAGCCCTCT |
original cDNA sequence snippet | N/A |
altered cDNA sequence snippet | N/A |
wildtype AA sequence | MIIISNNSLP ITEWIRPNSK ALVVILSSGA LSIGQIILGG LAYVFRDWQT LHVVASVPFF VFFLLSRWLV ESARWLIITN KLDEGLKALR KVARTNGIKN AEETLNIEVV RSTMQEELDA AQTKTTVCDL FRNPSMRKRI CILVFLR* |
mutated AA sequence | N/A |
speed | 0.35 s |
|
|