Yum, tasty mutations...

mutation t@sting

documentation

Prediction

disease causing

Model: without_aae, prob: 1 (classification due to ClinVar, real probability is shown anyway)      (explain)
Summary
  • known disease mutation at this position (HGMD CM980216)
  • known disease mutation: rs37392 (pathogenic)
  • protein features (might be) affected
  • splice site changes
hyperlink
analysed issue analysis result
name of alteration no title
alteration (phys. location) chr17:41267761C>TN/A show variant in all transcripts   IGV
HGNC symbol BRCA1
Ensembl transcript ID ENST00000591534
Genbank transcript ID N/A
UniProt peptide P38398
alteration type single base exchange
alteration region intron
DNA changes g.54530G>A
AA changes N/A
position(s) of altered AA
if AA alteration in CDS
N/A
frameshift N/A
known variant Reference ID: rs80357498
Allele 'T' was neither found in ExAC nor 1000G.
known disease mutation: rs37392 (pathogenic for Breast neoplasm|Hereditary breast and ovarian cancer syndrome|Breast-ovarian cancer, familial 1|Hereditary cancer-predisposing syndrome|not provided) dbSNP  NCBI variation viewer
known disease mutation at this position, please check HGMD for details (HGMD ID CM980216)

known disease mutation at this position, please check HGMD for details (HGMD ID CM980216)
known disease mutation at this position, please check HGMD for details (HGMD ID CM980216)
regulatory features H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation
phyloP / phastCons
PhyloPPhastCons
(flanking)0.9151
3.4531
(flanking)2.9020.975
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
splice sites splice site change before start ATG (at aa -13) |
effectgDNA positionscoredetection sequence  exon-intron border
Donor gained545260.64mu: CCACAAAGTATGACC ACAA|agta
distance from splice site 9527
Kozak consensus sequence altered? N/A
conservation
protein level for non-synonymous changes
N/A
protein features
start (aa)end (aa)featuredetails 
35HELIXmight get lost (downstream of altered splice site)
821HELIXmight get lost (downstream of altered splice site)
2465ZN_FINGRING-type.might get lost (downstream of altered splice site)
2527STRANDmight get lost (downstream of altered splice site)
2626MUTAGENI->A: Disrupts the interaction with E2 enzymes, thereby abolishing the E3 ubiquitin-protein ligase activity.might get lost (downstream of altered splice site)
2626MUTAGENI->E: No ubiquitination of RBBP8. No restoration RBBP8-mediated focus formation or G2/M checkpoint control upon DNA damage.might get lost (downstream of altered splice site)
4653HELIXmight get lost (downstream of altered splice site)
5458STRANDmight get lost (downstream of altered splice site)
6264TURNmight get lost (downstream of altered splice site)
7072TURNmight get lost (downstream of altered splice site)
7171MUTAGENR->G: No effect on interaction with BAP1.might get lost (downstream of altered splice site)
7880STRANDmight get lost (downstream of altered splice site)
8196HELIXmight get lost (downstream of altered splice site)
8989CONFLICTI -> T (in Ref. 4; AAB61673).might get lost (downstream of altered splice site)
148148CONFLICTMissing (in Ref. 4; AAB61673).might get lost (downstream of altered splice site)
253253CONFLICTA -> V (in Ref. 3; AAC00049).might get lost (downstream of altered splice site)
308308MOD_RESPhosphoserine; by AURKA.might get lost (downstream of altered splice site)
308308MUTAGENS->N: Abolishes phosphorylation by AURKA and interferes with cell cycle progression from G2 to mitosis.might get lost (downstream of altered splice site)
395395MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
398398MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
403403MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
651654COMPBIASPoly-Lys.might get lost (downstream of altered splice site)
753753MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
840840MOD_RESPhosphoserine (By similarity).might get lost (downstream of altered splice site)
988988MOD_RESPhosphoserine; by CHEK2.might get lost (downstream of altered splice site)
10771077CONFLICTG -> R (in Ref. 4; AAB61673).might get lost (downstream of altered splice site)
11431143MUTAGENS->A: Reduces in vitro phosphorylation by ATR.might get lost (downstream of altered splice site)
11431143MOD_RESPhosphoserine; by ATR; in vitro.might get lost (downstream of altered splice site)
12111211MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
12121212MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
12171217MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
12181218MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
12391239MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
12391239MUTAGENS->A: No effect on in vitro phosphorylation by ATR.might get lost (downstream of altered splice site)
12451245MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
12801280MOD_RESPhosphoserine; by ATR; in vitro.might get lost (downstream of altered splice site)
12801280MUTAGENS->A: Reduces in vitro phosphorylation by ATR.might get lost (downstream of altered splice site)
12981298MUTAGENS->A: No effect on in vitro phosphorylation by ATR.might get lost (downstream of altered splice site)
13301330MUTAGENS->A: No effect on in vitro phosphorylation by ATR.might get lost (downstream of altered splice site)
13301330MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
13361336MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
13421342MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
13871387MOD_RESPhosphoserine; by ATM and ATR.might get lost (downstream of altered splice site)
13871387MUTAGENS->A: Loss of IR-induced S-phase checkpoint. Reduces in vitro phosphorylation by ATR.might get lost (downstream of altered splice site)
13941394MOD_RESPhosphothreonine; by ATR; in vitro.might get lost (downstream of altered splice site)
13941394MUTAGENT->A: Reduces in vitro phosphorylation by ATR.might get lost (downstream of altered splice site)
13971424REGIONInteraction with PALB2.might get lost (downstream of altered splice site)
14231423MOD_RESPhosphoserine; by ATM and ATR.might get lost (downstream of altered splice site)
14231423MUTAGENS->A: Inhibition of the infrared-induced G2 arrest. Reduces phosphorylation by ATR.might get lost (downstream of altered splice site)
14261426CONFLICTS -> P (in Ref. 3; AAC00049).might get lost (downstream of altered splice site)
14531453CONFLICTMissing (in Ref. 3; AAC00049).might get lost (downstream of altered splice site)
14571457MUTAGENS->A: Reduces in vitro phosphorylation by ATR.might get lost (downstream of altered splice site)
14571457MOD_RESPhosphoserine; by ATR; in vitro.might get lost (downstream of altered splice site)
14661466MUTAGENS->A: No effect on in vitro phosphorylation by ATR.might get lost (downstream of altered splice site)
14661466MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
15241524MUTAGENS->A: No change in infrared S-phase delay; when associated with A-1387. No effect on in vitro phosphorylation by ATR.might get lost (downstream of altered splice site)
15241524MOD_RESPhosphoserine; by ATM.might get lost (downstream of altered splice site)
15421542MOD_RESPhosphoserine.might get lost (downstream of altered splice site)
16421736DOMAINBRCT 1.might get lost (downstream of altered splice site)
16511656STRANDmight get lost (downstream of altered splice site)
16551655MUTAGENS->A: Abolishes interaction with BRIP1.might get lost (downstream of altered splice site)
16591672HELIXmight get lost (downstream of altered splice site)
16751679STRANDmight get lost (downstream of altered splice site)
16861689STRANDmight get lost (downstream of altered splice site)
16951697STRANDmight get lost (downstream of altered splice site)
17001700MOD_RESPhosphothreonine.might get lost (downstream of altered splice site)
17011708HELIXmight get lost (downstream of altered splice site)
17021702MUTAGENK->M: Abolishes interaction with BRIP1.might get lost (downstream of altered splice site)
17121715STRANDmight get lost (downstream of altered splice site)
17171724HELIXmight get lost (downstream of altered splice site)
17201720MUTAGENT->A: No effect on in vitro phosphorylation by ATR.might get lost (downstream of altered splice site)
17201720MOD_RESPhosphothreonine.might get lost (downstream of altered splice site)
17251727STRANDmight get lost (downstream of altered splice site)
17311734HELIXmight get lost (downstream of altered splice site)
17381738MUTAGENG->E: Abolishes interaction with BRIP1.might get lost (downstream of altered splice site)
17401742TURNmight get lost (downstream of altered splice site)
17431745STRANDmight get lost (downstream of altered splice site)
17481753HELIXmight get lost (downstream of altered splice site)
17551755MUTAGENS->A: No effect on in vitro phosphorylation by ATR.might get lost (downstream of altered splice site)
17551757TURNmight get lost (downstream of altered splice site)
17561855DOMAINBRCT 2.might get lost (downstream of altered splice site)
17601763TURNmight get lost (downstream of altered splice site)
17651768STRANDmight get lost (downstream of altered splice site)
17701772STRANDmight get lost (downstream of altered splice site)
17731775STRANDmight get lost (downstream of altered splice site)
17771786HELIXmight get lost (downstream of altered splice site)
17891791STRANDmight get lost (downstream of altered splice site)
17951797HELIXmight get lost (downstream of altered splice site)
18011803STRANDmight get lost (downstream of altered splice site)
18061810STRANDmight get lost (downstream of altered splice site)
18121814HELIXmight get lost (downstream of altered splice site)
18191822HELIXmight get lost (downstream of altered splice site)
18251827TURNmight get lost (downstream of altered splice site)
18281830STRANDmight get lost (downstream of altered splice site)
18321834STRANDmight get lost (downstream of altered splice site)
18351844HELIXmight get lost (downstream of altered splice site)
18511853HELIXmight get lost (downstream of altered splice site)
length of protein N/A
AA sequence altered N/A
position of stopcodon in wt / mu CDS N/A
position (AA) of stopcodon in wt / mu AA sequence N/A
position of stopcodon in wt / mu cDNA N/A
poly(A) signal N/A
conservation
nucleotide level for all changes - no scoring up to now
N/A
position of start ATG in wt / mu cDNA 103 / 103
chromosome 17
strand -1
last intron/exon boundary 1043
theoretical NMD boundary in CDS 890
length of CDS 1065
coding sequence (CDS) position N/A
cDNA position
(for ins/del: last normal base / first normal base)
N/A
gDNA position
(for ins/del: last normal base / first normal base)
54530
chromosomal position
(for ins/del: last normal base / first normal base)
41267761
original gDNA sequence snippet GGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAGT
altered gDNA sequence snippet GGAACCTGTCTCCACAAAGTATGACCACATATTTTGCAAGT
original cDNA sequence snippet N/A
altered cDNA sequence snippet N/A
wildtype AA sequence MHSCSGSLQN RNYPSQEELI KVVDVEEQQL EESGPHDLTE TSYLPRQDLE GTPYLESGIS
LFSDDPESDP SEDRAPESAR VGNIPSSTSA LKVPQLKVAE SAQSPAAAHT TDTAGYNAME
ESVSREKPEL TASTERVNKR MSMVVSGLTP EEFMLVYKFA RKHHITLTNL ITEETTHVVM
KTDAEFVCER TLKYFLGIAG GKWVVSYFWV TQSIKERKML NEHDFEVRGD VVNGRNHQGP
KRARESQDRK IFRGLEICCY GPFTNMPTDQ LEWMVQLCGA SVVKELSSFT LGTGVHPIVV
VQPDAWTEDN GFHAIGQMCE APVVTREWVL DSVALYQCQE LDTYLIPQIP HSHY*
mutated AA sequence N/A
speed 0.85 s
All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project