mutation t@sting |
documentation |
Prediction |
polymorphism |
Model: without_aae, prob: 0.000114072781583659 (classification due to TGP/ExAC, real probability is shown anyway) (explain) | |||||||||||||||||||||||||
Summary |
|
hyperlink | |||||||||||||||||||||||||
analysed issue | analysis result | ||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
name of alteration | no title | ||||||||||||||||||||||||||
alteration (phys. location) | chr2:74725178G>AN/A show variant in all transcripts IGV | ||||||||||||||||||||||||||
HGNC symbol | LBX2 | ||||||||||||||||||||||||||
Ensembl transcript ID | ENST00000341396 | ||||||||||||||||||||||||||
Genbank transcript ID | N/A | ||||||||||||||||||||||||||
UniProt peptide | N/A | ||||||||||||||||||||||||||
alteration type | single base exchange | ||||||||||||||||||||||||||
alteration region | 3'UTR | ||||||||||||||||||||||||||
DNA changes | cDNA.417C>T g.7015C>T | ||||||||||||||||||||||||||
AA changes | N/A | ||||||||||||||||||||||||||
position(s) of altered AA if AA alteration in CDS | N/A | ||||||||||||||||||||||||||
frameshift | N/A | ||||||||||||||||||||||||||
known variant | Reference ID: rs17009998
| ||||||||||||||||||||||||||
regulatory features | DNase1, Open Chromatin, DNase1 Hypersensitive Site ELF1, Transcription Factor, ELF1 Transcription Factor Binding Gene Associated, Regulatory Feature, Gene associated regulatory feature H3K27ac, Histone, Histone 3 Lysine 27 Acetylation H3K27me3, Histone, Histone 3 Lysine 27 Tri-Methylation H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation H3K4me2, Histone, Histone 3 Lysine 4 Di-Methylation H3K4me3, Histone, Histone 3 Lysine 4 Tri-Methylation PolII, Polymerase, RNA Polymerase II Promoter Associated, Regulatory Feature, Promoter like regulatory feature TAF1, Transcription Factor, TAF1 Transcription Factor Binding | ||||||||||||||||||||||||||
phyloP / phastCons |
| ||||||||||||||||||||||||||
splice sites | splice site change occurs after stopcodon (at aa 99)
| ||||||||||||||||||||||||||
distance from splice site | 268 | ||||||||||||||||||||||||||
Kozak consensus sequence altered? | N/A | ||||||||||||||||||||||||||
conservation protein level for non-synonymous changes | N/A | ||||||||||||||||||||||||||
protein features | N/A | ||||||||||||||||||||||||||
length of protein | N/A | ||||||||||||||||||||||||||
AA sequence altered | N/A | ||||||||||||||||||||||||||
position of stopcodon in wt / mu CDS | N/A | ||||||||||||||||||||||||||
position (AA) of stopcodon in wt / mu AA sequence | N/A | ||||||||||||||||||||||||||
position of stopcodon in wt / mu cDNA | N/A | ||||||||||||||||||||||||||
poly(A) signal | signal is predicted to be ok | ||||||||||||||||||||||||||
conservation nucleotide level for all changes - no scoring up to now | N/A | ||||||||||||||||||||||||||
position of start ATG in wt / mu cDNA | 126 / 126 | ||||||||||||||||||||||||||
chromosome | 2 | ||||||||||||||||||||||||||
strand | -1 | ||||||||||||||||||||||||||
last intron/exon boundary | 150 | ||||||||||||||||||||||||||
theoretical NMD boundary in CDS | cannot be calculated, too little distance between start ATG and last intron/exon boundary | ||||||||||||||||||||||||||
length of CDS | 174 | ||||||||||||||||||||||||||
coding sequence (CDS) position | N/A | ||||||||||||||||||||||||||
cDNA position (for ins/del: last normal base / first normal base) | 417 | ||||||||||||||||||||||||||
gDNA position (for ins/del: last normal base / first normal base) | 7015 | ||||||||||||||||||||||||||
chromosomal position (for ins/del: last normal base / first normal base) | 74725178 | ||||||||||||||||||||||||||
original gDNA sequence snippet | CGCCTCGCTACGCGCGTTGTCCCCGGAAGTCCTGTGCAGCT | ||||||||||||||||||||||||||
altered gDNA sequence snippet | CGCCTCGCTACGCGCGTTGTTCCCGGAAGTCCTGTGCAGCT | ||||||||||||||||||||||||||
original cDNA sequence snippet | CGCCTCGCTACGCGCGTTGTCCCCGGAAGTCCTGTGCAGCT | ||||||||||||||||||||||||||
altered cDNA sequence snippet | CGCCTCGCTACGCGCGTTGTTCCCGGAAGTCCTGTGCAGCT | ||||||||||||||||||||||||||
wildtype AA sequence | MGKRTSLEGG QVRTRWALVP SAANGASHAL RSPRNRCWSW SGASSSRSTW RRPSETG* | ||||||||||||||||||||||||||
mutated AA sequence | N/A | ||||||||||||||||||||||||||
speed | 0.44 s | ||||||||||||||||||||||||||