Prediction |
polymorphism |
Model: without_aae, prob: 0.999998238262633 (classification due to TGP/ExAC,
real probability is shown anyway)
(explain) |
| Summary |
- homozygous in TGP or ExAC
- protein features (might be) affected
- splice site changes
|
hyperlink |
| analysed issue |
analysis result |
| name of alteration | no title |
| alteration (phys. location) | chr3:12875443G>AN/A
show variant in all transcripts IGV
|
| HGNC symbol | CAND2 |
| Ensembl transcript ID | ENST00000454887 |
| Genbank transcript ID | N/A |
| UniProt peptide | O75155 |
| alteration type | single base exchange |
| alteration region | intron |
| DNA changes | g.37473G>A |
| AA changes | N/A |
position(s) of altered AA
if AA alteration in CDS | N/A |
| frameshift | N/A |
| known variant | Reference ID: rs12629133
| database | homozygous (A/A) | heterozygous | allele carriers |
| 1000G | 540 | 1178 | 1718 |
| ExAC | 19243 | -5719 | 13524 |
|
| regulatory features | PolII, Polymerase, RNA Polymerase II
H3K36me3, Histone, Histone 3 Lysine 36 Tri-Methylation
H4K20me1, Histone, Histone 4 Lysine 20 mono-methylation |
| phyloP / phastCons | | PhyloP | PhastCons |
| (flanking) | -2.132 | 0 | | 0.15 | 0.007 | | (flanking) | 0.801 | 0.076 |
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser |
| splice sites | | effect | gDNA position | score | wt detection sequence | exon-intron border | | Donor gained | 37473 | 0.44 | mu: ATTCCACTTCAGCCC | TCCA|cttc |
|
| distance from splice site | 2372 |
| Kozak consensus sequence altered? | N/A |
conservation
protein level for non-synonymous changes | N/A |
| protein features | | start (aa) | end (aa) | feature | details | | | 83 | 119 | REPEAT | HEAT 3. | might get lost (downstream of altered splice site) | | 129 | 167 | REPEAT | HEAT 4. | might get lost (downstream of altered splice site) | | 171 | 208 | REPEAT | HEAT 5. | might get lost (downstream of altered splice site) | | 204 | 204 | CONFLICT | A -> T (in Ref. 6; BAA31642). | might get lost (downstream of altered splice site) | | 210 | 246 | REPEAT | HEAT 6. | might get lost (downstream of altered splice site) | | 254 | 291 | REPEAT | HEAT 7. | might get lost (downstream of altered splice site) | | 327 | 368 | REPEAT | HEAT 8. | might get lost (downstream of altered splice site) | | 343 | 346 | COMPBIAS | Poly-Asp. | might get lost (downstream of altered splice site) | | 372 | 409 | REPEAT | HEAT 9. | might get lost (downstream of altered splice site) | | 432 | 469 | REPEAT | HEAT 10. | might get lost (downstream of altered splice site) | | 490 | 493 | COMPBIAS | Poly-Ser. | might get lost (downstream of altered splice site) | | 517 | 554 | REPEAT | HEAT 11. | might get lost (downstream of altered splice site) | | 565 | 604 | REPEAT | HEAT 12. | might get lost (downstream of altered splice site) | | 608 | 645 | REPEAT | HEAT 13. | might get lost (downstream of altered splice site) | | 614 | 618 | COMPBIAS | Poly-Leu. | might get lost (downstream of altered splice site) | | 648 | 685 | REPEAT | HEAT 14. | might get lost (downstream of altered splice site) | | 690 | 727 | REPEAT | HEAT 15. | might get lost (downstream of altered splice site) | | 731 | 770 | REPEAT | HEAT 16. | might get lost (downstream of altered splice site) | | 772 | 813 | REPEAT | HEAT 17. | might get lost (downstream of altered splice site) | | 857 | 894 | REPEAT | HEAT 18. | might get lost (downstream of altered splice site) | | 896 | 931 | REPEAT | HEAT 19. | might get lost (downstream of altered splice site) | | 933 | 966 | REPEAT | HEAT 20. | might get lost (downstream of altered splice site) | | 967 | 1003 | REPEAT | HEAT 21. | might get lost (downstream of altered splice site) | | 1007 | 1044 | REPEAT | HEAT 22. | might get lost (downstream of altered splice site) | | 1048 | 1084 | REPEAT | HEAT 23. | might get lost (downstream of altered splice site) | | 1105 | 1141 | REPEAT | HEAT 24. | might get lost (downstream of altered splice site) | | 1157 | 1194 | REPEAT | HEAT 25. | might get lost (downstream of altered splice site) | | 1173 | 1173 | MOD_RES | N6-acetyllysine. | might get lost (downstream of altered splice site) | | 1204 | 1236 | REPEAT | HEAT 26. | might get lost (downstream of altered splice site) |
|
| length of protein | N/A |
| AA sequence altered | N/A |
| position of stopcodon in wt / mu CDS | N/A |
| position (AA) of stopcodon in wt / mu AA sequence | N/A |
| position of stopcodon in wt / mu cDNA | N/A |
| poly(A) signal | N/A |
conservation
nucleotide level for all changes - no scoring up to now | N/A |
| position of start ATG in wt / mu cDNA | 1 / 1 |
| chromosome | 3 |
| strand | 1 |
| last intron/exon boundary | 470 |
| theoretical NMD boundary in CDS | 419 |
| length of CDS | 492 |
| coding sequence (CDS) position | N/A |
cDNA position
(for ins/del: last normal base / first normal base) | N/A |
gDNA position
(for ins/del: last normal base / first normal base) | 37473 |
chromosomal position
(for ins/del: last normal base / first normal base) | 12875443 |
| original gDNA sequence snippet | AAAGCATCCAGAAGGATTCCGCTTCAGCCCCCAGCACAGAC |
| altered gDNA sequence snippet | AAAGCATCCAGAAGGATTCCACTTCAGCCCCCAGCACAGAC |
| original cDNA sequence snippet | N/A |
| altered cDNA sequence snippet | N/A |
| wildtype AA sequence | MGPFKHTVDD GLDVRKAAFE CMYSLLESCL GQLDICEFLN HVEDGLKDHY DIRMLTFIMV
ARLATLCPAP VLQRVDRLIE PLRATCTAKE PNANSVAWNT QCEDMHALLL GRRLPQHQSQ
HLPYAPAEAA GLCGRLQWLQ DLLPPCLLHF CRGGAADWRG RRP* |
| mutated AA sequence | N/A |
| speed | 0.91 s |
|
|
